ID: 992286644

View in Genome Browser
Species Human (GRCh38)
Location 5:75242291-75242313
Sequence TTTGCAGTCCCTGAGCTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992286644_992286647 0 Left 992286644 5:75242291-75242313 CCATCAAGCTCAGGGACTGCAAA No data
Right 992286647 5:75242314-75242336 ATATCTTGGGCACTGATTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992286644 Original CRISPR TTTGCAGTCCCTGAGCTTGA TGG (reversed) Intergenic
No off target data available for this crispr