ID: 992291675

View in Genome Browser
Species Human (GRCh38)
Location 5:75285811-75285833
Sequence CAGTTTGGGCGCATGTTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992291669_992291675 11 Left 992291669 5:75285777-75285799 CCCTAAAATGTATAAAACCAGAC No data
Right 992291675 5:75285811-75285833 CAGTTTGGGCGCATGTTGTCAGG No data
992291670_992291675 10 Left 992291670 5:75285778-75285800 CCTAAAATGTATAAAACCAGACT No data
Right 992291675 5:75285811-75285833 CAGTTTGGGCGCATGTTGTCAGG No data
992291671_992291675 -6 Left 992291671 5:75285794-75285816 CCAGACTATGCTCTGACCAGTTT No data
Right 992291675 5:75285811-75285833 CAGTTTGGGCGCATGTTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992291675 Original CRISPR CAGTTTGGGCGCATGTTGTC AGG Intergenic
No off target data available for this crispr