ID: 992293551

View in Genome Browser
Species Human (GRCh38)
Location 5:75304899-75304921
Sequence TGAGAGCAGCACCACCATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992293548_992293551 11 Left 992293548 5:75304865-75304887 CCCAGGTCAGAGAACAAGAGGCT 0: 47
1: 242
2: 166
3: 84
4: 530
Right 992293551 5:75304899-75304921 TGAGAGCAGCACCACCATCTTGG No data
992293549_992293551 10 Left 992293549 5:75304866-75304888 CCAGGTCAGAGAACAAGAGGCTT 0: 48
1: 247
2: 172
3: 62
4: 160
Right 992293551 5:75304899-75304921 TGAGAGCAGCACCACCATCTTGG No data
992293547_992293551 12 Left 992293547 5:75304864-75304886 CCCCAGGTCAGAGAACAAGAGGC 0: 46
1: 243
2: 163
3: 67
4: 245
Right 992293551 5:75304899-75304921 TGAGAGCAGCACCACCATCTTGG No data
992293545_992293551 19 Left 992293545 5:75304857-75304879 CCAAGAACCCCAGGTCAGAGAAC 0: 284
1: 171
2: 65
3: 40
4: 202
Right 992293551 5:75304899-75304921 TGAGAGCAGCACCACCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992293551 Original CRISPR TGAGAGCAGCACCACCATCT TGG Intergenic
No off target data available for this crispr