ID: 992293768

View in Genome Browser
Species Human (GRCh38)
Location 5:75306476-75306498
Sequence CCCTTTACTGCCCATGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992293765_992293768 -2 Left 992293765 5:75306455-75306477 CCTACAACTGCCTTGGTAAATCC No data
Right 992293768 5:75306476-75306498 CCCTTTACTGCCCATGAAGCAGG No data
992293763_992293768 8 Left 992293763 5:75306445-75306467 CCTTTCTTTACCTACAACTGCCT No data
Right 992293768 5:75306476-75306498 CCCTTTACTGCCCATGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992293768 Original CRISPR CCCTTTACTGCCCATGAAGC AGG Intergenic
No off target data available for this crispr