ID: 992294475

View in Genome Browser
Species Human (GRCh38)
Location 5:75313899-75313921
Sequence CTGAAAATACAAAATAAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992294475_992294481 11 Left 992294475 5:75313899-75313921 CCCAGCTTATTTTGTATTTTCAG No data
Right 992294481 5:75313933-75313955 TTTCACCCTGTTGGTCAGGCTGG 0: 186
1: 20982
2: 137316
3: 181184
4: 222024
992294475_992294479 2 Left 992294475 5:75313899-75313921 CCCAGCTTATTTTGTATTTTCAG No data
Right 992294479 5:75313924-75313946 GAGACAGGGTTTCACCCTGTTGG 0: 331
1: 34322
2: 88846
3: 134605
4: 115907
992294475_992294480 7 Left 992294475 5:75313899-75313921 CCCAGCTTATTTTGTATTTTCAG No data
Right 992294480 5:75313929-75313951 AGGGTTTCACCCTGTTGGTCAGG 0: 45
1: 5941
2: 59027
3: 169838
4: 227257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992294475 Original CRISPR CTGAAAATACAAAATAAGCT GGG (reversed) Intergenic
No off target data available for this crispr