ID: 992295177

View in Genome Browser
Species Human (GRCh38)
Location 5:75320472-75320494
Sequence GAAATTTTCAGAGCCTTCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992295177_992295180 7 Left 992295177 5:75320472-75320494 CCCCAGAAGGCTCTGAAAATTTC No data
Right 992295180 5:75320502-75320524 TCTGTGAATTTCTCAATCTGTGG No data
992295177_992295181 25 Left 992295177 5:75320472-75320494 CCCCAGAAGGCTCTGAAAATTTC No data
Right 992295181 5:75320520-75320542 TGTGGTCATCGCTATATAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992295177 Original CRISPR GAAATTTTCAGAGCCTTCTG GGG (reversed) Intergenic
No off target data available for this crispr