ID: 992295180

View in Genome Browser
Species Human (GRCh38)
Location 5:75320502-75320524
Sequence TCTGTGAATTTCTCAATCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992295177_992295180 7 Left 992295177 5:75320472-75320494 CCCCAGAAGGCTCTGAAAATTTC No data
Right 992295180 5:75320502-75320524 TCTGTGAATTTCTCAATCTGTGG No data
992295179_992295180 5 Left 992295179 5:75320474-75320496 CCAGAAGGCTCTGAAAATTTCAA No data
Right 992295180 5:75320502-75320524 TCTGTGAATTTCTCAATCTGTGG No data
992295178_992295180 6 Left 992295178 5:75320473-75320495 CCCAGAAGGCTCTGAAAATTTCA No data
Right 992295180 5:75320502-75320524 TCTGTGAATTTCTCAATCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992295180 Original CRISPR TCTGTGAATTTCTCAATCTG TGG Intergenic