ID: 992295181 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 5:75320520-75320542 |
Sequence | TGTGGTCATCGCTATATAAG CGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
992295177_992295181 | 25 | Left | 992295177 | 5:75320472-75320494 | CCCCAGAAGGCTCTGAAAATTTC | No data | ||
Right | 992295181 | 5:75320520-75320542 | TGTGGTCATCGCTATATAAGCGG | No data | ||||
992295178_992295181 | 24 | Left | 992295178 | 5:75320473-75320495 | CCCAGAAGGCTCTGAAAATTTCA | No data | ||
Right | 992295181 | 5:75320520-75320542 | TGTGGTCATCGCTATATAAGCGG | No data | ||||
992295179_992295181 | 23 | Left | 992295179 | 5:75320474-75320496 | CCAGAAGGCTCTGAAAATTTCAA | No data | ||
Right | 992295181 | 5:75320520-75320542 | TGTGGTCATCGCTATATAAGCGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
992295181 | Original CRISPR | TGTGGTCATCGCTATATAAG CGG | Intergenic | ||