ID: 992299228

View in Genome Browser
Species Human (GRCh38)
Location 5:75360915-75360937
Sequence TTTCTTCCCTTGAAGAAAAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 445
Summary {0: 1, 1: 0, 2: 4, 3: 46, 4: 394}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992299228 Original CRISPR TTTCTTCCCTTGAAGAAAAC AGG (reversed) Exonic
901386827 1:8915396-8915418 TTTCTCCTTTTAAAGAAAACAGG + Intergenic
903083002 1:20827340-20827362 TTTCTTCCTTTGAAACAAAATGG - Intronic
903498582 1:23789178-23789200 TTCTCTCCCTTGCAGAAAACAGG + Intergenic
904084683 1:27896955-27896977 TCTCTTCCCTGGAAGAACACAGG - Intronic
904129459 1:28264971-28264993 TTTCTGCACTTGCAGAAACCTGG + Intronic
905152031 1:35937093-35937115 TTTCCTCCCTTGAAAATAAAAGG - Intronic
907237192 1:53060958-53060980 GTTCTTCCCATGATGGAAACAGG - Intergenic
908202700 1:61814077-61814099 TTTCTTCTAGTGAAGAAAACAGG - Intronic
908506346 1:64804976-64804998 TTTCTTCTTTTGTAGAAACCCGG + Exonic
909364867 1:74807713-74807735 CTTTTTCCCATGAAGAAGACAGG - Intergenic
909603690 1:77487325-77487347 TTTATTTCCATGAGGAAAACTGG - Intronic
909740250 1:79019838-79019860 TTTCTTGCATTAAAGAAGACTGG - Intergenic
909781892 1:79558378-79558400 TTTCTTCCCTTCAAGAAAGAGGG - Intergenic
910060086 1:83080508-83080530 TTTCTTCTCTTTAAGATAAACGG - Intergenic
910549872 1:88463339-88463361 TCCCTTCCCTCGAAGAAAAAAGG + Intergenic
910936820 1:92490235-92490257 TATATTCCATTTAAGAAAACAGG - Intergenic
910971278 1:92858371-92858393 TATCTTCCCTTGTGGAAAGCTGG + Intronic
911349400 1:96734597-96734619 TTTCATTTGTTGAAGAAAACTGG + Intronic
911461270 1:98194093-98194115 TTTCTTTCCTTCAACAAAAGAGG + Intergenic
913045932 1:115073472-115073494 TTTCTTCCCATTCAGAAAAGTGG - Intronic
913495037 1:119420745-119420767 TGTCTTCCCTTGAAGAAGGAAGG - Intronic
913595711 1:120374360-120374382 GTTCCTCCCTTGAACAAAACTGG + Intergenic
914091564 1:144504616-144504638 GTTCCTCCCTTGAACAAAACTGG - Intergenic
914307036 1:146429559-146429581 GTTCCTCCCTTGAACAAAACTGG + Intergenic
914595070 1:149143552-149143574 GTTCCTCCCTTGAACAAAACTGG - Intergenic
915578434 1:156797261-156797283 TTTCTTCTCTTGCAGAAGAAAGG + Exonic
915957210 1:160231400-160231422 TTTCTACTCTTAAAGGAAACTGG - Exonic
916676457 1:167067829-167067851 TTTCTTTCCTTTAAAAAAAATGG - Intronic
917546784 1:175978120-175978142 TTTCTTCCCTTAAAAAAGGCAGG + Intronic
917593523 1:176502875-176502897 TTTCTTCCAGTTAATAAAACCGG + Intronic
917935544 1:179863250-179863272 TTGCCTCCATTGAAGAAATCAGG - Intronic
918462563 1:184791580-184791602 ATATTTCCCTTGAAAAAAACTGG - Exonic
918553396 1:185770495-185770517 TTTCTTGTCCTGAAGAAAAATGG + Intronic
918808929 1:189090406-189090428 TTAATACCCTTTAAGAAAACAGG - Intergenic
919537260 1:198803289-198803311 TTTCTTCCTTGAAAGAAACCTGG + Intergenic
919679026 1:200415684-200415706 ATTCTTCCCTTTGAGAAAATAGG - Intergenic
921147853 1:212376692-212376714 CTTGCTTCCTTGAAGAAAACTGG + Intronic
921703935 1:218298399-218298421 TTTCTCTCCTTGAAGAACTCAGG - Intronic
922153344 1:223023008-223023030 TTTCTGCCCCTGGAGACAACTGG - Intergenic
923001742 1:230011803-230011825 CTTCTTTCCTTGAACAAAGCAGG + Intergenic
923021361 1:230166781-230166803 TTTCTCCCTTTGAAGATAAGGGG + Intronic
923122956 1:231010547-231010569 CTTCTTCCCTTGGAGAAAAAAGG - Intergenic
924305569 1:242685272-242685294 ATTCTTCCCTTAATGGAAACAGG + Intergenic
1064478199 10:15714445-15714467 TTTCTTCTATTGAAGTAAAGAGG + Intronic
1065403847 10:25340089-25340111 TTTTTTCCCTTGAAGACACAGGG - Intronic
1065484326 10:26222387-26222409 TTTCCTCACTTGAAAAAAAAAGG + Intronic
1066983733 10:42444342-42444364 TTACTTCCCAGGAAGAAAATTGG + Intergenic
1067990576 10:51207230-51207252 TTTTTTCCTTTTAAGAAAACTGG - Intronic
1070693786 10:78546863-78546885 TTAGTTCCCTTGAATAAAACAGG - Intergenic
1071803668 10:89093018-89093040 TGTCCTTCCTTGAAGAAAAGTGG + Intergenic
1071843236 10:89494868-89494890 TCCCCTCCCTGGAAGAAAACTGG + Intronic
1071896769 10:90076245-90076267 GTTCTTCCCTTCAAGACAGCAGG + Intergenic
1072174127 10:92899248-92899270 TTTCTTCCCTGAAATAGAACTGG - Intronic
1072384265 10:94908369-94908391 TTTTTTTGCCTGAAGAAAACTGG + Intergenic
1073138133 10:101230772-101230794 TTTCTGCCCTTGGAGAAAGGAGG + Intergenic
1074131644 10:110584240-110584262 TTTCTTCTTTTGATGTAAACTGG - Exonic
1074665352 10:115716315-115716337 TTTTTTCCTTTGAGGAAAATGGG - Intronic
1075394674 10:122118326-122118348 TTTCTTACCTTGACTGAAACTGG + Intronic
1075402182 10:122168927-122168949 TTTCTTCCCTTTAAGATTAATGG + Intronic
1077746947 11:4916932-4916954 TTTCTTCCTCTGTAGAAGACTGG - Intronic
1079423720 11:20319421-20319443 TTGGTTCCCTTGAAGAAGAGAGG + Intergenic
1080400801 11:31933939-31933961 TTCCTGCCCTGGAAGAAATCAGG + Intronic
1081203064 11:40241657-40241679 TTTCTAGCCTTGCAGAAAAATGG - Intronic
1081249076 11:40807061-40807083 CTTCATCCCTTTAAGAAAACTGG + Intronic
1081522057 11:43891586-43891608 TTTCCTCCCTTGAATCAAAAAGG + Intronic
1081586152 11:44385318-44385340 TTTGTTCCATTGAGGAAAAGAGG + Intergenic
1083312766 11:61793189-61793211 TTTCCTCCATTGTAGAAAAGCGG + Intronic
1084470897 11:69358460-69358482 GTTCTTTCCTTGAAGAAAATGGG + Intronic
1084754914 11:71231875-71231897 TTTTTTTCCTTGAAGACACCTGG - Intronic
1084966272 11:72746288-72746310 TGTCTCCCCTTCAAGAAATCTGG - Intronic
1085206869 11:74739824-74739846 TTTCTTCTCTTGAAACAAAAAGG + Intergenic
1086290201 11:85300197-85300219 TCTCTTCCCATGAAGATAATTGG - Intronic
1086739926 11:90354173-90354195 TTGTTTCCTTTGAGGAAAACTGG - Intergenic
1087011372 11:93517066-93517088 TTTCTTCCAAGGAAGAAAGCAGG + Intronic
1087345336 11:96964722-96964744 ATTCTTCCCTTGAAGAAAGTGGG - Intergenic
1087802218 11:102516708-102516730 TTTCATCCCTTTAACAAAAATGG - Intergenic
1087963643 11:104384938-104384960 TTTCTTCATTTGTAGAAAAATGG + Intergenic
1089045133 11:115495219-115495241 TTTCTTCTTTTGAATAAAAAAGG - Intronic
1089343236 11:117773770-117773792 TTTCTGCACTTGGAGAAGACTGG + Intronic
1090224320 11:125060884-125060906 TCTGTCCCTTTGAAGAAAACAGG + Intergenic
1091171167 11:133520881-133520903 TTTTTTCCCATGGAGAACACTGG - Intronic
1092723874 12:11466713-11466735 GTTCTTCCCTTCCAGAAAAGTGG + Intronic
1093162825 12:15768600-15768622 TTTTCTCCCTTCAAAAAAACTGG - Intronic
1093531808 12:20174701-20174723 TTTCTGCCCTTCAAGGAACCAGG + Intergenic
1094152981 12:27306657-27306679 TAGCTTCCCTTAAAGAAAGCAGG + Intronic
1094153164 12:27309031-27309053 TAACTTCCCTTAAAGAAAGCAGG - Intronic
1094448367 12:30558300-30558322 GTTTTTCTCTTGAAGAAAAGGGG - Intergenic
1095614059 12:44167764-44167786 TTTCTTCCCTAGAAGAGTAGAGG + Intronic
1096787859 12:54028022-54028044 GTTCTTCCCTTGGAGAAATCAGG + Intronic
1099549929 12:84031225-84031247 TTTCTTCACCTGAAGAATAGAGG - Intergenic
1100105199 12:91162295-91162317 TTTCTTCCTTTAAAAAAATCTGG + Intronic
1101391738 12:104307164-104307186 CTGCTTACCTTGAAGAAAAAAGG + Intronic
1102077919 12:110074542-110074564 TTTGTTGCTTTCAAGAAAACAGG - Intergenic
1103778154 12:123381861-123381883 TTTCTTCCCTAAAAGAATGCAGG + Intergenic
1104353720 12:128067135-128067157 TGTTTTCCCGTGAAGAAAAAGGG - Intergenic
1104453458 12:128890083-128890105 TTTCTTGCCTTTTAGAAAACTGG - Intronic
1105319014 13:19299195-19299217 CTTCTTCCCATATAGAAAACAGG + Intergenic
1106690868 13:32114704-32114726 TTCCTCCCATTGAAGAAAAAGGG - Intronic
1107195729 13:37649207-37649229 ATGCTTCCCTTGAGGTAAACAGG - Intronic
1107256375 13:38432453-38432475 TTTCTGCCTTTGAACAAACCAGG + Intergenic
1107386085 13:39911111-39911133 TTTCTTCCCTTCAACACCACAGG - Intergenic
1108215971 13:48184866-48184888 TTCCTTCCCTTGAAGAAAAGGGG + Intergenic
1108461884 13:50675144-50675166 ATTCTTCCCTTGAGGCAAAAGGG - Intronic
1108719437 13:53116096-53116118 ATTCTTCCCTTGAACAAAACAGG + Intergenic
1108969418 13:56354057-56354079 TTTCTTACCTTTAAAACAACAGG - Intergenic
1108999834 13:56785280-56785302 TTTCTTCCTTTGTAGCAAAATGG + Intergenic
1109157991 13:58935413-58935435 TTTTTTCTCTTGAAGTAAAAAGG - Intergenic
1109269855 13:60242932-60242954 TTGCTTCCCATGAAGGAAAGAGG + Intergenic
1109662357 13:65479653-65479675 TTTCTACCCTTTAATACAACTGG - Intergenic
1110915784 13:81019096-81019118 TGTCTGGCTTTGAAGAAAACAGG - Intergenic
1111145449 13:84172970-84172992 TTTCTTCTCTAGAATAAAAATGG - Intergenic
1111217975 13:85169190-85169212 TTTCTTCCCCAGAAGAAAAGTGG + Intergenic
1112134697 13:96563945-96563967 TTTGTTGCCTTGCAGATAACAGG + Intronic
1112618909 13:101034920-101034942 GTTCTTCCCTTCAAGACAGCAGG + Intergenic
1114821735 14:26028663-26028685 TTTCTTCCTGTGAAGAATGCTGG - Intergenic
1114827232 14:26095613-26095635 TTTCTTCCATCAAACAAAACTGG - Intergenic
1115090757 14:29571837-29571859 TTTCATGCCTTGTTGAAAACTGG - Intergenic
1115782630 14:36786650-36786672 TTTTTTCTCTTGAAGCAAAGAGG + Intronic
1116690895 14:48104223-48104245 TTTCAGCCCTTGAACAAAGCGGG + Intergenic
1116940612 14:50787237-50787259 TTTCTGCCCTGGTTGAAAACAGG - Intronic
1118303714 14:64637035-64637057 TTTTTTACCTTGAAGAGAACTGG + Intergenic
1118863560 14:69684542-69684564 TTTCTGACCATTAAGAAAACTGG - Intronic
1119185053 14:72634760-72634782 TTTCTTGCTCTAAAGAAAACTGG - Intronic
1120396849 14:83978221-83978243 TTTCTTCCCTGGAAGAAATATGG - Intergenic
1120743202 14:88130458-88130480 ATTCTTCCTGTGAAGAAAGCGGG + Intergenic
1120890122 14:89484211-89484233 TTTCTCCCCATTAAGAAAATAGG - Intronic
1121786234 14:96663256-96663278 TTTCTTCTCTGGAAGTGAACGGG - Intergenic
1124881633 15:33648313-33648335 TTTCTTGACTGGAAGAAAAAAGG - Intronic
1125244785 15:37622244-37622266 TTTCTTCCCATCAAAAAAAAAGG + Intergenic
1126631317 15:50738812-50738834 TTTTTTTCCTTGAAGAAAGTGGG - Intronic
1127401621 15:58592574-58592596 CTGGTTCCCTTGAAGAAAAATGG + Exonic
1127887912 15:63219758-63219780 TTTTTTCCATGAAAGAAAACTGG + Intronic
1128658652 15:69481718-69481740 TTTTTTCCCTTTAAGAATAATGG - Intergenic
1131109285 15:89754688-89754710 TTTCATACCATGAAGAAAGCTGG - Intergenic
1131119763 15:89814869-89814891 TTACTTCCCTTTAAAAAGACGGG - Intronic
1131315144 15:91329197-91329219 TTTCTTCCCTTCAAGGCAGCAGG + Intergenic
1131871849 15:96771897-96771919 TATCTTCTCATGAAGAAACCTGG + Intergenic
1131951876 15:97690128-97690150 TCCCTTCCCTTTAAGAAAAAGGG + Intergenic
1132165418 15:99582941-99582963 CTTCTTCCGTGGAAGAGAACTGG - Intronic
1132228096 15:100159493-100159515 TTTCTTTCTTTAAATAAAACTGG + Intronic
1133554673 16:6894040-6894062 TTTCTTCCTTTGCATAATACTGG + Intronic
1137065571 16:35838560-35838582 TTTCTCCCCTTGCCGAAAAATGG - Intergenic
1137270589 16:46900210-46900232 TTTCCTCCCTAGATGAAAACTGG - Intronic
1137653763 16:50142505-50142527 TTTATTAACTTGAACAAAACAGG - Intergenic
1138895751 16:61202140-61202162 ATTCTTGACTTGAAGAACACTGG + Intergenic
1139016311 16:62693059-62693081 TTTTTTCACTTAAATAAAACTGG + Intergenic
1139247093 16:65455680-65455702 TTTCATCTTTTGAAGAACACAGG - Intergenic
1141619601 16:85229905-85229927 TTTCTTCCCCTAAAGAGAAAAGG - Intergenic
1142694405 17:1625602-1625624 TTTCTGGCCTGAAAGAAAACTGG + Intronic
1143368414 17:6423173-6423195 TTCCCACCCTTGAAGAAAAGGGG - Intronic
1143418005 17:6764155-6764177 TTTCTTCTTTTGAGGAAAATGGG + Intronic
1143795835 17:9335997-9336019 TTTCTTAGCTTGAAGCAACCAGG + Intronic
1144263603 17:13547122-13547144 TTTCTTCCCTTGAGGTGAATGGG - Intronic
1145078749 17:19876851-19876873 TTCCTTCCTTTGAAGAAGGCTGG - Intergenic
1146094585 17:29917052-29917074 TTTCCTCACTTAAAGAAAAAGGG - Intronic
1147877416 17:43631591-43631613 TTTCCTCTCTTGAAGACAAATGG + Intergenic
1148587738 17:48792818-48792840 TTTCTCCACTTGAAAAAAATTGG - Intronic
1149014288 17:51890035-51890057 TTTCTTCAGTTGAAGAAAAGGGG + Intronic
1149153192 17:53594366-53594388 TTTCTTCCCTTCAAGGCAATGGG + Intergenic
1149380564 17:56089126-56089148 TTTCTTGTTTTGAAGAAAATAGG + Intergenic
1149644926 17:58233695-58233717 TTTCTTCTCTTAATGAATACAGG - Intronic
1150998311 17:70344790-70344812 TTTCTTTTTTTAAAGAAAACAGG - Intergenic
1151119039 17:71771807-71771829 TTTGTTCACTTCAAAAAAACTGG + Intergenic
1152081880 17:78192622-78192644 TTTCTTTCTTTAAAGAAATCTGG + Intronic
1152308946 17:79537623-79537645 TTTCTGCCTTTGAACAAAAACGG + Intergenic
1152823841 17:82450961-82450983 TTTCTTTTTTTCAAGAAAACTGG - Intergenic
1153898954 18:9598090-9598112 TGTGTTACCTTGAAGAAAAAGGG + Intronic
1153982102 18:10319156-10319178 TTTCTACACTTGAAGAATGCTGG + Intergenic
1154183728 18:12161315-12161337 TTTTTTCCCTTGAATAAAAAAGG - Intergenic
1156064965 18:33129460-33129482 TTTATGCCCTTGAAAAAAAGTGG + Intronic
1156751166 18:40457501-40457523 CTACTTCCCTATAAGAAAACAGG + Intergenic
1157356810 18:46942909-46942931 TTTCTTCCTTTAAAGAATGCCGG + Intronic
1157508545 18:48250368-48250390 TTTCCTCCGTTGTAGAAAAGGGG + Intronic
1157714713 18:49875820-49875842 TGTCTTCCTTTGAAGGAAATTGG - Exonic
1157984542 18:52422030-52422052 TGTTTTCCTTTAAAGAAAACTGG + Intronic
1158116833 18:54005271-54005293 TTTCTTCCCTTCAAGGTAGCAGG - Intergenic
1159371990 18:67539876-67539898 TTTCTTCCCAGGGAGAAAAATGG + Intergenic
1159674426 18:71264078-71264100 TTTCTTACCTTGAGAAAAATTGG + Intergenic
1159986841 18:74852289-74852311 TTTATACCCTTGAATTAAACAGG + Intronic
1161627580 19:5336244-5336266 TTTCTTTCCTTAAAGGAAAAGGG + Intronic
1161785412 19:6322071-6322093 CTTTCTCCTTTGAAGAAAACAGG - Intronic
1162686584 19:12390661-12390683 TTCATGTCCTTGAAGAAAACGGG + Exonic
1162690916 19:12430351-12430373 TTCATGTCCTTGAAGAAAACGGG + Exonic
1162832281 19:13293041-13293063 TTTCTTCCTCTGAAGAAGAGAGG + Intronic
1165565100 19:36718936-36718958 ATTCTTTTCTAGAAGAAAACTGG + Exonic
1165603018 19:37074204-37074226 TTTTTTACCATGAAGAAATCAGG + Intronic
1165649592 19:37474077-37474099 TTTCTGCCCTTAAAGAAACATGG - Intronic
1166542753 19:43616401-43616423 TTTCTTCCAGAGAAGGAAACAGG - Intronic
925604399 2:5643713-5643735 GTTCCTCCCTTGAACAAAACTGG + Intergenic
925747911 2:7059880-7059902 TTTCTTCTCTTGAGTAAAAGTGG + Intronic
925902125 2:8516129-8516151 TTTCTTCCCATGAGGACACCTGG - Intergenic
926278846 2:11427848-11427870 TTTCTTTTTTTGAAGAAAAATGG + Intergenic
926645088 2:15282269-15282291 CTTCTTTCCTTGAAGAACTCTGG - Intronic
927291238 2:21406941-21406963 TTTCCTCCCTGGAAAAGAACTGG + Intergenic
929015026 2:37485361-37485383 TATCTTCTCTTGAAAAAACCTGG + Intergenic
929129763 2:38555537-38555559 TTTCTGAGCTTGAAGAAATCTGG - Intergenic
929854624 2:45626438-45626460 TATCTTCCTTAGAAGATAACTGG - Intergenic
929982580 2:46695801-46695823 TTTGTGACCTTGAAGAAAATGGG + Intergenic
930538585 2:52675543-52675565 TATTTTCCATGGAAGAAAACTGG + Intergenic
931023302 2:58076003-58076025 TTTCTCCCCCTTAAGAAGACAGG + Intronic
931046346 2:58358139-58358161 TTTTTTTCCATGAAGAATACAGG - Intergenic
932102254 2:68911913-68911935 CTTCCTCCCCTGGAGAAAACTGG + Intergenic
933147687 2:78875267-78875289 TTTCTTGCATTGGAGAAAGCTGG - Intergenic
933612318 2:84450039-84450061 TTTATTTCCTAGAAAAAAACTGG + Intronic
935292516 2:101622211-101622233 TTTCCTCCTCTGAAGAAAAGGGG - Intergenic
935680789 2:105635430-105635452 TGTTTTCCCTTGAAGACAAAAGG - Intergenic
936097113 2:109538959-109538981 TTTTTACTTTTGAAGAAAACAGG + Intergenic
936245715 2:110825598-110825620 TTTTTTCCCATGAATCAAACAGG + Intronic
936269030 2:111034350-111034372 TTTCTTCCCTTTAAGGAACAAGG - Intronic
936603693 2:113925720-113925742 TTTCCTTCCTTAAAGCAAACTGG + Intronic
936768806 2:115886892-115886914 TTTTTTCTTTTGAAGATAACAGG - Intergenic
936964151 2:118110679-118110701 TTTCTTTCATTGAAAAAAATAGG - Intronic
939016361 2:136908752-136908774 TTCCTCCCCATAAAGAAAACTGG - Intronic
939035661 2:137128077-137128099 TTTCTTCCATTGAACTAAAATGG + Intronic
939405414 2:141749426-141749448 TTTCTTTCCTGGGTGAAAACAGG - Intronic
939558487 2:143705726-143705748 TTTCTTCAGTTGAAAAAAAAGGG - Intronic
940223083 2:151374133-151374155 TTTCTTCACTGGAAGACAGCAGG + Intronic
941949533 2:171139632-171139654 TTTGATGCCTTGAAGATAACCGG - Intronic
942821151 2:180117013-180117035 TGTCTTCCCTTGGAGCAATCCGG + Intergenic
943169996 2:184386035-184386057 TTCCTTCCCTTCAAGACATCAGG - Intergenic
943809092 2:192161656-192161678 TTTCTTCTGTTAAAGAAAACAGG + Intronic
944653895 2:201858760-201858782 TTTTTTCCCTTGGTGAAAGCAGG - Intronic
944824331 2:203466238-203466260 TATCATCCCTGGAACAAAACTGG + Intronic
945205792 2:207330847-207330869 TTTATAACCTTTAAGAAAACAGG + Intergenic
946861858 2:224007775-224007797 TTTTTTCTGTTGAAAAAAACAGG + Intronic
948049096 2:234966046-234966068 TTTGTTTCCTTAAAGACAACGGG - Intronic
948714730 2:239853652-239853674 ATTTTTCCCTTGAAGAAGAGAGG + Intergenic
1169974721 20:11311727-11311749 TTTCTTCCCTTGGAGTCACCTGG + Intergenic
1172825262 20:37777639-37777661 TTTTTTCCCCTTTAGAAAACAGG + Exonic
1172998671 20:39090163-39090185 TGTCTTCCCCTAAAGATAACAGG - Intergenic
1173011590 20:39188028-39188050 TTTCTTCCCTTAAGGAAAAATGG - Intergenic
1173444601 20:43106342-43106364 TTTCTAAACTGGAAGAAAACTGG - Intronic
1174066385 20:47868728-47868750 TTTCTTCTCCTGAACAAACCAGG - Intergenic
1174899014 20:54478940-54478962 TTTCATCCATTGAAAAAATCTGG - Intronic
1175639775 20:60619329-60619351 TTTCTTGCCTTGTAAAAAAGAGG + Intergenic
1175674498 20:60935105-60935127 TGCCTTCCCATGAAGAGAACAGG + Intergenic
1176078232 20:63258884-63258906 GTTCTTCCTTTGAAAAAAAAGGG + Intronic
1177102179 21:16912063-16912085 TTTATTCCCATCCAGAAAACTGG - Intergenic
1177538115 21:22455877-22455899 TTTCTTCCCCTGAATAAAAAGGG - Intergenic
1179838496 21:44054218-44054240 TTTCTTCCCTCAAAGACAAAGGG - Intronic
1180501769 22:15936220-15936242 TTTTTTCCCTTGGGTAAAACTGG + Intergenic
1181298020 22:21857688-21857710 GTTATTCCTTTGAAGTAAACAGG - Intronic
1182903523 22:33918876-33918898 TTTCTCCCCTTGAAGGAAGCAGG + Intronic
1184233986 22:43173487-43173509 TTTTTTCCCTTGTAGAAACGAGG + Intronic
1184305852 22:43601323-43601345 TTTCTTTCTTTAAAGAAAATTGG - Intronic
950864028 3:16174832-16174854 TTTTTTCCCAAGGAGAAAACCGG + Exonic
951090925 3:18573255-18573277 GTTCTGCCCTTGAAGACAAGGGG + Intergenic
951459310 3:22932279-22932301 TTTCTTCCCCTCTAGAAAATGGG - Intergenic
951620488 3:24596164-24596186 TTTCCTCCCTTAAAAAAAATTGG + Intergenic
951904531 3:27690879-27690901 TATCTTCACTGGAAGAAGACAGG + Intergenic
952050777 3:29381880-29381902 TTCCTTTCCTGAAAGAAAACAGG + Intronic
952110240 3:30114633-30114655 TTTCTTTCCTTAAATAACACAGG - Intergenic
952785120 3:37146124-37146146 TTTCCTCCCTTACAGAAATCTGG + Intronic
953614511 3:44477892-44477914 TTTCTTCCCTGGAGGGAAAGAGG - Intergenic
953618263 3:44510916-44510938 TTTCTTCCCTGAAGGAAAAGAGG - Intergenic
954014974 3:47680458-47680480 TTTTTTCCATTGAAGAACTCAGG + Exonic
954961551 3:54569780-54569802 TTTAATCCCTAGAAGAAAAATGG - Exonic
955314874 3:57929483-57929505 TTTCTATTCTTGAGGAAAACTGG - Intergenic
956223710 3:66932995-66933017 TTGCTTCCCTTTAAGTAAACTGG + Intergenic
956983036 3:74662271-74662293 TTTTTTCCCTTGCAGAAAACAGG - Intergenic
957862295 3:85969835-85969857 TTTCTTCTCTTGAAAACAGCGGG - Intronic
959223060 3:103546478-103546500 GTTCTTCCATTGAAGCATACAGG - Intergenic
961103763 3:124223634-124223656 TTTCTTCACTTGTTGAAATCAGG + Intronic
961134262 3:124495410-124495432 TTTCTTCTGTTCAAGAAAACAGG - Intronic
961459088 3:127039027-127039049 TGTCTTGCCCTGAAGAAAACTGG + Intergenic
961847671 3:129781110-129781132 TTTCTTCTATTAAAGAACACGGG + Intronic
962017510 3:131457262-131457284 CTTCTTCCCATAGAGAAAACAGG + Intergenic
962068318 3:132007113-132007135 ATTCTTCTCTTGAAGAAATGAGG + Intronic
963297872 3:143566569-143566591 TGACTTCCATTTAAGAAAACAGG - Intronic
964899112 3:161636120-161636142 TTTCTTGCATTGAAGTTAACAGG + Intergenic
965562711 3:170077020-170077042 TTTTTCCCCATGAGGAAAACAGG - Intronic
966290236 3:178347287-178347309 TTTTTTTTCTTGAAGGAAACTGG - Intergenic
966575160 3:181492883-181492905 CAGCTTCCCTTGAAGAATACAGG - Intergenic
967898662 3:194423924-194423946 TTTTTTAATTTGAAGAAAACTGG - Intronic
968409048 4:370359-370381 TATCTTCCATTGAAAATAACAGG - Intronic
968950009 4:3685673-3685695 TTTCTTCCCTAAGAGACAACGGG + Intergenic
969837330 4:9852553-9852575 TTTCTTTTCTTTAAGAATACTGG - Intronic
969930513 4:10626427-10626449 TTTCTTTCCTGTAAGACAACTGG + Intronic
972847841 4:43011079-43011101 TTTCTTCCCTTCAGGACTACAGG + Intronic
972956604 4:44400122-44400144 TTTCATTACTAGAAGAAAACAGG + Intronic
973164946 4:47065297-47065319 TTTCTTCCCTTGAACCCAAATGG + Intronic
973167927 4:47100890-47100912 TTTCTTGACTTTAAGAAAGCTGG - Intronic
973300175 4:48573236-48573258 TTAGTTCCCTGGAAGAAAAATGG + Exonic
974160895 4:58137361-58137383 TTTCTTCACTTTATGAAAACTGG + Intergenic
974893295 4:67907547-67907569 GTCCTTCCCTTCAAGGAAACAGG + Intergenic
975359244 4:73447638-73447660 TTTTTTCCCCTGAAGAAAATTGG - Exonic
976176614 4:82360518-82360540 TTTCTACCCTTTAAAAAGACAGG + Intronic
978557763 4:109999081-109999103 TTTCTCTCATTGAAGAAAATAGG + Intronic
978832601 4:113106850-113106872 TTTCTGCCCTTAACTAAAACTGG + Intronic
978881488 4:113708690-113708712 TTTCTTCCCTTCAAAATAAAAGG + Intronic
979767327 4:124477443-124477465 TTTCTACGCATGAAGACAACAGG - Intergenic
979785315 4:124710446-124710468 CTGCTTCCCTTGCAGTAAACTGG + Exonic
980485684 4:133455088-133455110 TTTCTTCTCTTGTAAAACACAGG - Intergenic
980528474 4:134019416-134019438 TTTCTTCATTTGAATAAAGCAGG + Intergenic
980530646 4:134048033-134048055 TTTATTCGATTGAAGAAATCAGG + Intergenic
980596907 4:134966484-134966506 TTTCTTCCCTTCAAGACACCAGG - Intergenic
981154732 4:141421222-141421244 TATCTTCACTAGAAGAAGACAGG - Intergenic
983291322 4:165809530-165809552 ATTATTGTCTTGAAGAAAACAGG - Intergenic
983447897 4:167877418-167877440 TTTCTTACCTTCCAGAAAAGTGG - Intergenic
984088457 4:175341001-175341023 CTTTTTTTCTTGAAGAAAACAGG - Intergenic
984202143 4:176737558-176737580 TTTCTTCACTTGATTAAAAAAGG + Intronic
984244281 4:177256346-177256368 TGTCTTCTCTTTGAGAAAACTGG - Intergenic
986112174 5:4730456-4730478 TCACTTCACTGGAAGAAAACTGG + Intergenic
986222017 5:5776475-5776497 TTTCTTCCATTCATGAAAACAGG - Intergenic
987273953 5:16342375-16342397 TTTCTTACAGTGAAGAGAACAGG - Intergenic
988054252 5:26072899-26072921 TTGCTTCCCATGAAGAAAACAGG - Intergenic
988151551 5:27388506-27388528 TTGATTCCCTTAAGGAAAACAGG + Intergenic
988570948 5:32365527-32365549 TTTATTCCGTTGAAGAATGCAGG + Intronic
988773242 5:34452410-34452432 TTGGTTCCTTTAAAGAAAACAGG + Intergenic
989270364 5:39526057-39526079 TCTCTTTCATTAAAGAAAACTGG - Intergenic
991165209 5:63559214-63559236 TATCTTCCCTTCAAAAAAAATGG - Intergenic
991303011 5:65147188-65147210 TTTCTTCATTAGAAGAAATCAGG - Intergenic
992125276 5:73633327-73633349 CTTCTTCCCTAGAAGAAAGGGGG - Intronic
992221582 5:74579177-74579199 TTTCTTCCCTTGTGATAAACAGG + Intergenic
992299228 5:75360915-75360937 TTTCTTCCCTTGAAGAAAACAGG - Exonic
992695772 5:79285330-79285352 TTTCTACACTTGATGAAAAAGGG - Intronic
992901302 5:81299970-81299992 TCCCTTCTCTTAAAGAAAACTGG + Intergenic
993959087 5:94274779-94274801 ATTCTCCCCTTGCAGAAAAAGGG + Intronic
995402034 5:111753803-111753825 TTTCTTCCCTTGATTAAAATTGG - Intronic
996168111 5:120251683-120251705 TTTCTTCCCTAGAAGGAGCCGGG + Intergenic
996268901 5:121578672-121578694 TTTTTTTCCTTTAAGAAAACAGG - Intergenic
996995527 5:129692324-129692346 TTTTTTCACATGGAGAAAACAGG - Intronic
997983296 5:138483959-138483981 TTATTTGTCTTGAAGAAAACAGG + Intergenic
998334383 5:141357732-141357754 TTTATTGCTTTAAAGAAAACTGG + Intronic
998396840 5:141824147-141824169 ATTCTGCCCTAGAAGAAACCCGG + Intergenic
999821996 5:155237610-155237632 TTTCTTGCCTTTAACAAAAGAGG - Intergenic
1001801683 5:174549732-174549754 TTTTTTACTTTTAAGAAAACAGG - Intergenic
1002014521 5:176308997-176309019 TTTCTTCTCTGGAATAAAGCAGG + Intronic
1002404108 5:179015668-179015690 TTTCTGGCCATGAAGAAGACTGG - Intergenic
1002821731 6:731750-731772 TTTCTTCCCTGAAAAAAAAGGGG + Intergenic
1003139752 6:3460573-3460595 TTTATTTCCTTGGAGATAACAGG + Intergenic
1008276221 6:49547654-49547676 TTTCTTTCCTTGAAGAATATTGG - Intergenic
1008731810 6:54491884-54491906 GTCCTTCCCTTTAAGGAAACAGG + Intergenic
1009336752 6:62500255-62500277 TTTATTTCCCTGAAGAAAATGGG - Intergenic
1009644921 6:66388617-66388639 TTATTTCCATTGAAGAAAAATGG + Intergenic
1010713694 6:79204694-79204716 TTTATGCCCTTGATGAAAAGGGG - Intronic
1011646756 6:89466326-89466348 TTACTTTCCTTGAAGAGAAATGG + Intronic
1011724424 6:90194958-90194980 TTTCTTCTCATCAAGAAAAAGGG - Intronic
1014453346 6:121607976-121607998 TTTCTTGCTATGAAGAAAGCAGG - Intergenic
1014455028 6:121624963-121624985 GTTCTTCCCTTCCAGAAAAGTGG + Intergenic
1014893156 6:126867695-126867717 TTTATTCCCCTAAAGAAAAATGG - Intergenic
1016115924 6:140285803-140285825 TTCCTTCCCTGGAAGAAGCCAGG - Intergenic
1016321468 6:142850982-142851004 TTTCATCACATGAATAAAACTGG - Intronic
1017137934 6:151164596-151164618 TGACTTCCCTTGGAGGAAACAGG - Intergenic
1017393484 6:153968578-153968600 TTGCTTCCCTTCAAATAAACTGG + Intergenic
1017398205 6:154028216-154028238 GTTCTTCCCTTGAAGACAGCAGG + Intronic
1018791930 6:167155203-167155225 TTTCTTCCCTTGAAACAGAAAGG - Intronic
1018901832 6:168055520-168055542 CTTCTTCCTTTGAAGAAACTTGG - Intergenic
1019074379 6:169376273-169376295 TTTCTTCCATTGAATGAAAATGG + Intergenic
1020363154 7:7351565-7351587 TTTCTTAACTTGATTAAAACAGG + Intergenic
1020409944 7:7880835-7880857 TTTCTTCTCTTAAAGAAAAATGG + Intronic
1020567545 7:9817197-9817219 CCTCTTACCTTTAAGAAAACAGG - Intergenic
1020740067 7:12004748-12004770 CTTCCTCCCTAGAAGAAAAAGGG - Intergenic
1021830618 7:24604200-24604222 TTTCTTTTCTTGAAAGAAACAGG - Intronic
1021835520 7:24669470-24669492 TTCTCTCCCTTGAAGAAAGCAGG + Intronic
1023252165 7:38276483-38276505 TTACTGCCTTAGAAGAAAACAGG - Intergenic
1023305514 7:38821933-38821955 TTTCATCCCTTAAAGGAAAGGGG + Intronic
1023519022 7:41032276-41032298 ATTGTCCCCTTGAACAAAACTGG - Intergenic
1023901117 7:44479946-44479968 TTGTTTTCCTTGAACAAAACAGG - Intronic
1028022390 7:85792643-85792665 TTTCTTCCCTTCAAGACACTGGG - Intergenic
1028553292 7:92095496-92095518 CCTCTTCCCTAGGAGAAAACAGG - Intronic
1029854101 7:103495873-103495895 GCACTTCCCATGAAGAAAACTGG - Exonic
1030088260 7:105835757-105835779 TTTCTATCCTTTAAGAAAATGGG - Intronic
1030590477 7:111475265-111475287 TTTCTTTCCAAGAAGAGAACAGG - Intronic
1031159541 7:118149819-118149841 TCTCCTCTCTTCAAGAAAACAGG - Intergenic
1031256702 7:119460687-119460709 TTTCTTCCTTTGTAGAATACTGG - Intergenic
1031808181 7:126332686-126332708 TTTCTTGATTTAAAGAAAACAGG + Intergenic
1031885054 7:127237711-127237733 TTTCTACCCTTGAAGGATAGGGG - Intronic
1032536934 7:132672198-132672220 TTTCTTCCTTTGAAGAGCAGAGG - Intronic
1033014942 7:137662166-137662188 TATATTCCTTTGAAGAAAAAGGG - Intronic
1033904232 7:146182150-146182172 CTTCTTCCCTGAAAGCAAACTGG + Intronic
1034467069 7:151236066-151236088 TTCATTCCCTTGAAGAACAATGG + Intronic
1035329602 7:158087727-158087749 CTTCTTCCCTTGATGAAAGAGGG + Intronic
1035329972 7:158089752-158089774 CTTCTTCCCCTGATGAAAAGGGG + Intronic
1036523673 8:9515479-9515501 TTTTTTCCCCTTAAGAAAAATGG - Intergenic
1037205527 8:16315013-16315035 TTTCTTCCCTGGAAAAAGAAAGG - Intronic
1037590483 8:20307905-20307927 TTTCTACCCTGGAAAAAGACAGG - Intergenic
1037912691 8:22753449-22753471 TTTCTTCCCTTGGATATAGCTGG + Intronic
1039100841 8:33940432-33940454 TTTTTTCCCTTATAGAACACAGG + Intergenic
1041529172 8:58843228-58843250 TTTCTGCCATGCAAGAAAACTGG + Intronic
1041708403 8:60871042-60871064 TTTCTTCACTTGAACAAAGATGG + Intergenic
1041956657 8:63563843-63563865 TTTCTTCCCTTGATGTAGACAGG + Intergenic
1043173269 8:76992270-76992292 TTTCTTTACTTCAAGATAACAGG - Intronic
1044269616 8:90226322-90226344 TTACTTCACTTGAGGAAAAAAGG + Intergenic
1045068180 8:98471316-98471338 TTTCTGCCTTTTAAGAAAAGAGG + Intronic
1046386570 8:113514330-113514352 GTTCTTGCCCTGTAGAAAACCGG + Intergenic
1047596295 8:126380978-126381000 TTCCTTTCCTTGAAGAACATGGG + Intergenic
1047613496 8:126543684-126543706 TGTCTGCCATAGAAGAAAACTGG + Intergenic
1047775021 8:128062987-128063009 TTTCTTCCAGTGAGGAAACCAGG - Intergenic
1050085765 9:1964206-1964228 TTTCTTTGCTTGAGAAAAACAGG - Intergenic
1050469669 9:5973714-5973736 TTTCATCTCTTAAAAAAAACGGG + Intronic
1051316160 9:15835173-15835195 TTTATTCCCTAGAGGGAAACAGG + Intronic
1052025494 9:23569466-23569488 TTTCTTCCTCTGAAGAAGAGAGG + Intergenic
1052938653 9:34114496-34114518 TTTCTTCCCATGAAGAAGCAGGG - Intronic
1053634367 9:39981816-39981838 TTTATTCCCTTAAAAAAATCAGG - Intergenic
1053728856 9:41031902-41031924 TTTCTTCCCTTGTTTAAAATGGG - Intergenic
1054209520 9:62268881-62268903 TTTATTCCCTTAAAAAAATCAGG + Intergenic
1054699656 9:68400181-68400203 TTTCTTCCCTTGTTTAAAATGGG + Intronic
1055232899 9:74086834-74086856 GTTCTTACCTTCCAGAAAACTGG - Intergenic
1056331787 9:85527157-85527179 TTTCTTCCCTAGTAAAAAATAGG + Intergenic
1056332744 9:85535166-85535188 TTCCTGCCCTGGCAGAAAACTGG - Intergenic
1056534172 9:87513491-87513513 TTGCCTTCCTTGGAGAAAACTGG + Intronic
1058208663 9:102139560-102139582 TCTCATCCCTGGAAGAATACGGG - Intergenic
1059108833 9:111535427-111535449 TTTTTTCCCTTTAACAAAAATGG - Intronic
1059530730 9:115033078-115033100 ATTCTCCCATTGAAGAAAACAGG - Intronic
1059597374 9:115736346-115736368 TTTCTGCATATGAAGAAAACTGG + Intergenic
1059710527 9:116863726-116863748 CTTCTTCCCTTGGAGAGAAAGGG + Exonic
1059979371 9:119752939-119752961 GTAATTACCTTGAAGAAAACTGG + Intergenic
1060954457 9:127628646-127628668 TTTCTTTCCAAGAATAAAACAGG - Intronic
1061236638 9:129346940-129346962 TTTCTGTCCTTGAAGAATCCCGG + Intergenic
1186215686 X:7298091-7298113 ATTCTTCTCTTGAAAAAAAAGGG + Intronic
1186390726 X:9156149-9156171 TCACTTCCCTTGAACAAAATGGG - Intronic
1186986542 X:15020835-15020857 TTTCTTTGCTTGAAGAATATTGG - Intergenic
1187011300 X:15283045-15283067 TTTCTTTCCTTGAATAAATCTGG - Exonic
1187512503 X:19934243-19934265 TATCTTCCCTTAAGGAAAAAAGG + Intronic
1188909739 X:35832148-35832170 TTTCTTCTCTAGAAGAGAAATGG - Intergenic
1189013481 X:37071125-37071147 GTTCTTCCCTTCAAGGAAGCAGG + Intergenic
1189040668 X:37539269-37539291 GTTCTTCAGTGGAAGAAAACTGG + Intronic
1189593815 X:42543373-42543395 TTTCTTCCCTTCAAGGCAGCAGG - Intergenic
1189720465 X:43910817-43910839 TTCCTTCCCTTTTAGAAAATGGG + Intergenic
1190289384 X:48982201-48982223 TTTTTACCATTGATGAAAACAGG + Intronic
1190390360 X:49925180-49925202 TTTAGCCCCTTGGAGAAAACAGG + Exonic
1190780697 X:53592227-53592249 TTTTTTCTCCTGAGGAAAACTGG - Intronic
1190982602 X:55469589-55469611 TTTCTTACCTATAAGAAACCAGG + Intergenic
1190986097 X:55503594-55503616 TTTCTTACCTATAAGAAACCAGG - Intergenic
1191916928 X:66211732-66211754 ATTCATCCCTTGATGAACACAGG + Intronic
1192405953 X:70886733-70886755 TTTCTTCCTTTGAATAGAACAGG + Intronic
1192776242 X:74248613-74248635 TTTCTTCTGTGGAAGAAAATGGG - Intergenic
1192841153 X:74857424-74857446 GTCCTTCCCTTGAAGGCAACGGG - Intronic
1192938502 X:75887144-75887166 TTTATTCCCTTGGAGAAAGAGGG + Intergenic
1192972363 X:76246600-76246622 TATCTTCCCCAGAGGAAAACTGG - Intergenic
1193288851 X:79747361-79747383 ATTATTCCCTTGCAGAGAACAGG - Intergenic
1193422682 X:81302529-81302551 TTTCTTCCTTTGCAGATGACAGG - Intergenic
1193438710 X:81512580-81512602 GTTCTTCCCTTCAAGGAAACAGG - Intergenic
1193534472 X:82695800-82695822 TTACTTCACTAGAAGAAAATAGG + Intergenic
1194340685 X:92701181-92701203 GTTCTTCCCTTCAAGGAAGCAGG + Intergenic
1194551883 X:95311206-95311228 TTTTTTTCCTTCAAGAAAACAGG + Intergenic
1194909599 X:99624710-99624732 TTTCTTTCCTTAGATAAAACAGG - Intergenic
1195325040 X:103751634-103751656 TTTCTTAGTTTGTAGAAAACTGG - Intergenic
1197282160 X:124550025-124550047 TTTATTCCTTTGAAGAGAACAGG - Intronic
1199495437 X:148447245-148447267 TTTCCTCCGAGGAAGAAAACAGG - Intergenic
1200032206 X:153305978-153306000 TTTCTTCACCTGAAAAAAAATGG + Intergenic
1200314750 X:155120134-155120156 TTTCTTCTCTAGAATAAATCAGG + Exonic
1200895590 Y:8372896-8372918 TTCCTTCCCTTGAAAAAGTCAGG + Intergenic
1202023327 Y:20491571-20491593 GTTCTTCCCTTGAAAGCAACAGG - Intergenic