ID: 992301488

View in Genome Browser
Species Human (GRCh38)
Location 5:75386667-75386689
Sequence CAATTTATGAAGGACCTATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 135}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992301488 Original CRISPR CAATTTATGAAGGACCTATG GGG Intronic
906741314 1:48188121-48188143 CAGTTTATGAAGGATTTATTAGG + Intergenic
906936813 1:50221388-50221410 ATATTTATTAAGCACCTATGAGG - Intergenic
908554547 1:65244796-65244818 CAATATATGAAGAACTTAGGAGG + Intergenic
910693874 1:89992216-89992238 CAGTTTATGAAGGGCTTATTGGG + Intergenic
912516411 1:110219289-110219311 CATTTTATGGAGCACCTATTGGG + Intronic
914442004 1:147716046-147716068 CAAATCATGAAGGAGGTATGTGG + Intergenic
915132754 1:153707125-153707147 CAATTTAGGACGGACATATTGGG - Intergenic
915337886 1:155158104-155158126 CAACTTACGATGGACTTATGGGG - Intergenic
915983962 1:160444760-160444782 CAATTTATGATGGATTTATTGGG - Intergenic
916016445 1:160754149-160754171 ATATTTATTAAGAACCTATGCGG + Exonic
917551546 1:176036844-176036866 CAATTTATGATGGACTTATTGGG + Intronic
917610882 1:176687878-176687900 CAATTGATGAAGGACTTTTCGGG + Intronic
918875730 1:190040304-190040326 CAATTTATGATGCACTTATCAGG - Intergenic
924374773 1:243393784-243393806 CATTTTGTGAAAGACATATGTGG - Intronic
1063353574 10:5377567-5377589 CAAATGATGTAGGACCTGTGTGG - Intergenic
1065360946 10:24888427-24888449 CATTTTATCAAGGGCCTATTGGG - Intronic
1073773154 10:106757429-106757451 CAAATTATGTAGGAACTATGGGG - Intronic
1074047995 10:109856855-109856877 CACTTCATGAAGAAGCTATGTGG + Intergenic
1074849138 10:117424846-117424868 TAATTTGTGAATGACCTTTGTGG - Intergenic
1081688145 11:45056882-45056904 CAATTTGTGAAGGACTTCTGGGG + Intergenic
1085809610 11:79668126-79668148 CAATTTATTAAGGAACTACTGGG - Intergenic
1086118547 11:83281925-83281947 CAATTTATGATGGATTTATTGGG - Intronic
1086225648 11:84505760-84505782 GCATTTATCAAGGACATATGGGG + Intronic
1088864198 11:113831368-113831390 CAATTTAAGAAGGACTTGTAAGG - Intronic
1091892378 12:4069700-4069722 CAATTGCTGGAGGCCCTATGTGG - Intergenic
1094013329 12:25832545-25832567 CAATTTAGGTAGGACCAATGAGG - Intergenic
1095962745 12:47845636-47845658 CAATTTATTGAGCACCTATTAGG - Intronic
1102384391 12:112495635-112495657 CAATTTATGATGGGCTTATCAGG - Intronic
1105308490 13:19185790-19185812 AAATTTATGAAGAAGTTATGGGG - Intronic
1106670782 13:31902949-31902971 TCATTTATGAAGGCTCTATGTGG - Intergenic
1107549455 13:41461336-41461358 CAATTTCTAAAGCACCTCTGAGG - Intronic
1109326354 13:60871983-60872005 CAATTTATCAAAGAAATATGTGG + Intergenic
1115573779 14:34691587-34691609 CAATTTATGATGGATTTATCTGG + Intergenic
1115857707 14:37649117-37649139 CAATTTAGAAGGGACCTGTGTGG - Intronic
1116178404 14:41504292-41504314 GAATTTGTGAAGATCCTATGTGG - Intergenic
1117025264 14:51613084-51613106 CAGTTTATGGAGGACCTTTTTGG + Intronic
1119943509 14:78666913-78666935 AAATTTAGGGAGGAACTATGAGG - Intronic
1123100370 14:105793591-105793613 CAAGTTCTCAAGGACTTATGTGG - Intergenic
1123824331 15:24066408-24066430 CATTTTATGAAGCATTTATGAGG + Intergenic
1128486154 15:68091643-68091665 CAATTTATGATGGATTTATTGGG - Intronic
1128502014 15:68233282-68233304 CAATGTATGAAACACCTACGGGG + Intronic
1134394308 16:13848993-13849015 GAATTTAGGAAGGACCTCAGAGG - Intergenic
1134838072 16:17378608-17378630 CCATTTATGAAGCACGTATTAGG + Intronic
1137230218 16:46557720-46557742 CAATTTTTCAAGAACCTAAGGGG - Intergenic
1140196316 16:72858573-72858595 CAAGTTATGAATGACCTTTCTGG + Intronic
1141414701 16:83861429-83861451 CAATTTATGAAGATACAATGAGG + Intergenic
1144528791 17:16015893-16015915 CAATTTATGAAGGACCTTCCTGG + Intronic
1145364005 17:22238896-22238918 CTATTTTTGAAGAATCTATGAGG - Intergenic
1149105000 17:52952630-52952652 CAATTTCTGAAGGAATTATTTGG - Intergenic
1152135935 17:78503483-78503505 CAATTTAAGAAGAAAATATGTGG - Intronic
1153017123 18:593928-593950 CAATAGAAGAAGGAACTATGGGG - Intergenic
1153696559 18:7648941-7648963 CAACTTATGAAAGACCTAGATGG - Intronic
1155248854 18:23936886-23936908 CAATTGATGTAGGTCATATGAGG - Intronic
1155298687 18:24409032-24409054 GAATTTCTGCAGGAACTATGGGG + Intergenic
1157893706 18:51443483-51443505 CCATTGATGAAGGACATATAAGG + Intergenic
1157913126 18:51638208-51638230 CAATTGATTAAGGACCAAAGGGG - Intergenic
1159905349 18:74085105-74085127 CATTTTCTGAAGTACCTATTGGG - Intronic
1162154424 19:8667317-8667339 GAATTTATCAAGGTCATATGGGG - Intergenic
1164233826 19:23314895-23314917 CAAAATATGCAGCACCTATGTGG + Intronic
1164470493 19:28526193-28526215 CATTTTATGAAGGATTTAGGAGG - Intergenic
1165333982 19:35156288-35156310 CATTTTATGAAGGAGAAATGAGG - Intronic
1167745514 19:51349254-51349276 CAATTTATGATGGATTTATCAGG + Intronic
930095607 2:47563761-47563783 AAAGTTATGAAGGATCTTTGTGG + Intronic
931023322 2:58076221-58076243 CAATTTATGATGGACTTATGAGG - Intronic
931669294 2:64632313-64632335 AAATTTATGAACCACCTTTGTGG - Exonic
932028856 2:68162787-68162809 CAATTTATGATGGATTTATGAGG - Intronic
933414079 2:81962524-81962546 CAATTTATGAAGTGGTTATGTGG - Intergenic
935379696 2:102439130-102439152 AAATTTATGAAGGAACAATGGGG + Intronic
938299918 2:130202938-130202960 AAATTTATAAAGGAGTTATGGGG - Intergenic
938456793 2:131471547-131471569 AAATTTATAAAGGAGTTATGGGG + Intronic
938609672 2:132934703-132934725 ACATTTATGAAAGACCTATTTGG + Intronic
939113682 2:138037047-138037069 CAATTTAGGAAGGGCTTTTGAGG - Intergenic
940589348 2:155701283-155701305 CAGTTTCCCAAGGACCTATGTGG + Intergenic
941563618 2:167080213-167080235 CAATTTCTGAAGGAAAGATGTGG + Intronic
1169303903 20:4471655-4471677 CTCTTTATGAAGGATCAATGAGG - Intergenic
1169470454 20:5880875-5880897 CAATTTATGATGGATTTATCGGG + Intergenic
1173223863 20:41150386-41150408 CATTTTATGAGGGACTTTTGAGG + Intronic
1175671548 20:60907530-60907552 CAATTTTTCAGGGTCCTATGTGG - Intergenic
1177772016 21:25527468-25527490 CAATCTATGAAGGAAGTATTGGG - Intergenic
1178233808 21:30819014-30819036 CATTTGATGCAGAACCTATGTGG + Intergenic
1180882473 22:19215797-19215819 CATTTTATGAAGGTCTCATGTGG - Intronic
950982207 3:17319041-17319063 CAATTTTAGAAAGACTTATGAGG + Intronic
958142542 3:89580663-89580685 CAATTAATTGAGGACTTATGAGG - Intergenic
958975083 3:100658479-100658501 CAAATTATGTAGGAGCTTTGTGG - Intronic
961502179 3:127344275-127344297 CAATATATGAAGGAAATTTGGGG - Intergenic
962139944 3:132779421-132779443 CAACTTATGAAGGATTTATCAGG + Intergenic
963201287 3:142589057-142589079 CAAATTATGAAAGAGCTATGGGG - Intergenic
963419841 3:145047892-145047914 CAATTTAGGCAGGACTTATGTGG + Intergenic
965407735 3:168291529-168291551 CAATTTATTCAGTACCTATGTGG + Intergenic
967100825 3:186214591-186214613 AAATCTATTAAGGACATATGGGG - Intronic
967370219 3:188735890-188735912 TGATTTATGAAAGACCTGTGTGG + Intronic
968271164 3:197404788-197404810 CAAGTTATGAATCACCTCTGGGG - Intergenic
969898083 4:10323492-10323514 CAATTGTTGCAGGACCAATGAGG - Intergenic
971339585 4:25755598-25755620 AAATGTATGAAAGAACTATGGGG + Intronic
971962753 4:33510054-33510076 CAATTCATGGAGAACCTATATGG + Intergenic
974458460 4:62158802-62158824 CACTATATTAAGCACCTATGAGG - Intergenic
975167291 4:71191203-71191225 CAATTTATGATGGGCTTATCAGG + Intronic
975609017 4:76185672-76185694 CAATTTATCAAACACCTCTGAGG - Intronic
975721421 4:77252162-77252184 CAATTCATGAAGGACATAGCAGG + Intronic
980478428 4:133352048-133352070 CTAATTATGTAGGACCTAGGAGG - Intergenic
982790663 4:159587534-159587556 CAATTTAACAAGTACCTAGGAGG + Intergenic
983750696 4:171265776-171265798 CAATATAAGAAGGATATATGAGG + Intergenic
987072388 5:14350770-14350792 AAATTTATGAAGGATGTATGGGG - Intronic
987162377 5:15157575-15157597 TAATTTAGGAAGGTGCTATGTGG - Intergenic
987170239 5:15248393-15248415 CAATTTTTGATGTACATATGGGG + Intergenic
987759704 5:22145456-22145478 GAATTTGTCAAGGACCTATCAGG - Intronic
988620554 5:32818622-32818644 CAATTTATGATGGGCTTATTGGG + Intergenic
990679627 5:58227294-58227316 CAATTTATGATGGATTTATCAGG + Intergenic
991894429 5:71378883-71378905 GAATTTGTCAAGGACCTATCAGG - Intergenic
992301488 5:75386667-75386689 CAATTTATGAAGGACCTATGGGG + Intronic
994149352 5:96431110-96431132 CAAATCATGTATGACCTATGGGG - Intronic
995116119 5:108481704-108481726 CAATTTACGGAGGATCTCTGTGG - Intergenic
998959964 5:147475195-147475217 CAATTTTTGAAGGATATTTGGGG - Intronic
1000292113 5:159880119-159880141 CCATTTATGAAGGCCCTTTTTGG + Intergenic
1004719195 6:18250836-18250858 GAATTTATGAATGAACTATACGG + Intronic
1005772608 6:29090618-29090640 GAATTTGTGAACGACATATGTGG - Intergenic
1010878682 6:81140644-81140666 CAAGTTATTAGAGACCTATGAGG + Intergenic
1011490148 6:87883275-87883297 CAATTTATGAGGAACCCACGAGG - Intergenic
1011882288 6:92044379-92044401 AAATATAAGAAGGACATATGTGG + Intergenic
1012306363 6:97663059-97663081 GAATTTATGAATTAGCTATGAGG - Intergenic
1012432687 6:99182444-99182466 CATTTTAAGAAGTACATATGTGG - Intergenic
1013958139 6:115864621-115864643 CAATTTATAAAAGTCCTATGAGG - Intergenic
1016024621 6:139273385-139273407 CAATTTATGAAACACCTGTAGGG - Intronic
1020849433 7:13332362-13332384 CATTTCATCAAGGACCTACGTGG + Intergenic
1020977274 7:15022211-15022233 TAATTTATGAAGGATATATGAGG - Intergenic
1021701102 7:23320263-23320285 CTATTTATGAATGACCTTTCAGG - Intronic
1021813378 7:24424844-24424866 TAATCTATGTAGGACTTATGTGG + Intergenic
1028790911 7:94851675-94851697 CAATTTATCAGGGACTTAGGAGG + Intergenic
1031166359 7:118232662-118232684 CCATTTGTGGAGGACCTATTGGG + Intronic
1032544841 7:132733455-132733477 CAAGATATTAAGGACATATGTGG + Intergenic
1033002261 7:137519480-137519502 CAATAAATGAATGACCTAAGAGG + Intronic
1033050988 7:138003915-138003937 CAATTTATGATGGGTTTATGTGG - Intronic
1033643473 7:143284333-143284355 AAATTTAGGAAGGAACGATGTGG + Intronic
1036958539 8:13217344-13217366 CAATTCATGAAGGATGTGTGTGG + Intronic
1039753740 8:40500326-40500348 CTGTTTCTGCAGGACCTATGTGG - Intergenic
1043038950 8:75235220-75235242 CAATTTATGAATGACTTAACTGG + Intergenic
1044155581 8:88841944-88841966 GAATTTATGAAGGACGTTTAAGG - Intergenic
1044629300 8:94263187-94263209 CCATTTATTAAGTACCTCTGAGG + Intergenic
1047836286 8:128697033-128697055 TAGTTTATTAAGGACATATGAGG - Intergenic
1048551778 8:135439993-135440015 CAATTGATTGAAGACCTATGAGG - Intergenic
1051133547 9:13891484-13891506 TAATTTAAGAAGGACATTTGTGG - Intergenic
1058103794 9:100946920-100946942 CAATTTATGATGGATTTATCAGG - Intergenic
1186682370 X:11889273-11889295 CAATTTATGATGGGCTTATTGGG - Intergenic
1187486469 X:19708720-19708742 CATTTTAAGAAGCATCTATGGGG - Intronic
1189240440 X:39520452-39520474 CAATTTATAAATGACCTTTAGGG + Intergenic
1190632776 X:52404459-52404481 CAATTTATGATGGATTTATTGGG + Intergenic
1191578653 X:62735660-62735682 CAATCTATGAAGGACATTTGGGG - Intergenic
1191584175 X:62802346-62802368 CAATTTTTGTAGAATCTATGAGG - Intergenic
1192480348 X:71479922-71479944 AAATTTTTAAAAGACCTATGAGG + Intronic
1197010100 X:121550452-121550474 AAAGTTATGAAAGACATATGTGG + Intergenic
1198883987 X:141313282-141313304 AAATTTTTAAAGTACCTATGTGG - Intergenic