ID: 992301559

View in Genome Browser
Species Human (GRCh38)
Location 5:75387231-75387253
Sequence TCTAGGAACTGCCAGTGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 2, 1: 1, 2: 2, 3: 11, 4: 229}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992301559_992301563 2 Left 992301559 5:75387231-75387253 CCATGGCACTGGCAGTTCCTAGA 0: 2
1: 1
2: 2
3: 11
4: 229
Right 992301563 5:75387256-75387278 TGGTGCCAAAGGTGCAGAGCAGG 0: 2
1: 0
2: 2
3: 11
4: 239
992301559_992301561 -9 Left 992301559 5:75387231-75387253 CCATGGCACTGGCAGTTCCTAGA 0: 2
1: 1
2: 2
3: 11
4: 229
Right 992301561 5:75387245-75387267 GTTCCTAGATGTGGTGCCAAAGG 0: 1
1: 1
2: 0
3: 8
4: 140
992301559_992301565 6 Left 992301559 5:75387231-75387253 CCATGGCACTGGCAGTTCCTAGA 0: 2
1: 1
2: 2
3: 11
4: 229
Right 992301565 5:75387260-75387282 GCCAAAGGTGCAGAGCAGGGAGG 0: 2
1: 0
2: 3
3: 28
4: 396
992301559_992301564 3 Left 992301559 5:75387231-75387253 CCATGGCACTGGCAGTTCCTAGA 0: 2
1: 1
2: 2
3: 11
4: 229
Right 992301564 5:75387257-75387279 GGTGCCAAAGGTGCAGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992301559 Original CRISPR TCTAGGAACTGCCAGTGCCA TGG (reversed) Intronic
900142278 1:1143661-1143683 TCTAGGAACTGGCAGGGCAAGGG - Intergenic
901793844 1:11669001-11669023 TGTGGGAATTGCAAGTGCCAAGG - Intronic
902490159 1:16775595-16775617 TCCAGCATCTACCAGTGCCAGGG - Intronic
902515637 1:16988050-16988072 TCTGGGACCTGCCAGCTCCAAGG + Intronic
902791967 1:18775511-18775533 TGAAGGAACAGCCAGTGCAAAGG + Intergenic
902876612 1:19344286-19344308 GCTAGTAACTGGCAGAGCCAGGG + Intronic
903047398 1:20575133-20575155 TCCAGGAACAGCAAGTGCAAAGG + Intergenic
903278787 1:22238398-22238420 TCTAGGCACTAACTGTGCCAGGG - Intergenic
903557869 1:24206416-24206438 GGTAGGAACTGCCTGTGCCTGGG - Intergenic
903857694 1:26346377-26346399 TCCAAGAACTTCCAGAGCCATGG - Exonic
903908729 1:26706244-26706266 TCATGAATCTGCCAGTGCCAAGG - Intronic
904303816 1:29574053-29574075 TGTGGGAACAGCCAGTGCCTAGG + Intergenic
905885423 1:41489281-41489303 GCTAGGAAGTGGCAGAGCCAAGG + Intergenic
907132716 1:52110663-52110685 TCTGGGAACTGCCATGGCAAAGG - Intergenic
909151964 1:72018380-72018402 TTTAAGAACTACCAGTGCCTAGG + Intronic
909157554 1:72097724-72097746 TCTAAGAACTGACAATGCCTTGG + Intronic
911069097 1:93817915-93817937 TCTTGGCTCTGCCAGTCCCAAGG + Intronic
911298239 1:96143499-96143521 CCTAGGAATTCCAAGTGCCAGGG + Intergenic
913541738 1:119827461-119827483 TCCAGGAGTAGCCAGTGCCATGG - Intergenic
915050788 1:153070380-153070402 TCTGGGAACTGACAAAGCCAAGG + Exonic
918361297 1:183761018-183761040 TGAAGCAACTGCCAGTGCAATGG - Intronic
919473555 1:198008476-198008498 ACTAGGAACTGCCACAGTCAGGG - Intergenic
920689860 1:208137669-208137691 TCTAAGACCGGCCAGTCCCAGGG - Intronic
922141603 1:222893732-222893754 TCTAGGAGCTCCCGGAGCCAGGG - Intronic
923530279 1:234806935-234806957 TCCAGCATCTACCAGTGCCAGGG + Intergenic
924405176 1:243736871-243736893 TCTATGAAATGCCAGTTGCATGG - Intronic
1064013560 10:11755583-11755605 TCTAGGCACTGCTCTTGCCAAGG - Exonic
1065172656 10:23047522-23047544 GCTAGGAACTGCCAGAGAGAAGG + Intergenic
1065798466 10:29329108-29329130 TCTGGCAACTGCCATTGCCCTGG + Intergenic
1066656833 10:37704712-37704734 TGTGGGAACTGGCAATGCCAGGG - Intergenic
1067041363 10:42954950-42954972 TGTGGGAACTGGCAATGCCAGGG - Intergenic
1070276753 10:75014653-75014675 TCTAACAACTTCCTGTGCCATGG - Intronic
1070764334 10:79047951-79047973 TCTGGGCTCTGCCAGTGGCATGG - Intergenic
1070982505 10:80660726-80660748 TGTATGCACTGCCAATGCCATGG - Intergenic
1071480418 10:86061053-86061075 ACCAGGAAGGGCCAGTGCCATGG - Intronic
1072441462 10:95459755-95459777 GCTAGGAATTGCTAGAGCCATGG - Intronic
1074929496 10:118109317-118109339 ACCAGGAACTGCCAATCCCATGG - Intergenic
1075295363 10:121270519-121270541 ACTAGGAAATGTCAGGGCCAAGG - Intergenic
1075689796 10:124387277-124387299 GCAAGGAAGTGCCAGGGCCATGG - Intergenic
1075702021 10:124476024-124476046 TCTCTGAAGTGCCTGTGCCACGG - Intronic
1076659669 10:132047352-132047374 TCTGGAAACTGCTATTGCCACGG - Intergenic
1080445041 11:32330975-32330997 TCTGGGAACTGCCAGTTGCCAGG - Intergenic
1081226639 11:40532077-40532099 TCTAGAAACTACGAGTGCAATGG - Intronic
1081558887 11:44194001-44194023 TCAAGGAGCTGCCAGGGACATGG - Intronic
1084092340 11:66886888-66886910 GCTAGGATGTGTCAGTGCCACGG + Intronic
1084568410 11:69944590-69944612 TCCACCACCTGCCAGTGCCAGGG + Intergenic
1085284078 11:75348918-75348940 TCTAGGAACTCCCAGGGTCAAGG - Intronic
1085641074 11:78193133-78193155 TCTAGGCAGTGCCCGTGACAAGG - Intronic
1085664279 11:78399547-78399569 TCAAGGATCTGCCAGTCTCATGG - Intronic
1087779064 11:102284256-102284278 TCTAGGAACTGCCAGCAGCTGGG + Intergenic
1088932697 11:114368073-114368095 TCTAGGTGCTGTCAGTGACAAGG - Intergenic
1089164584 11:116465499-116465521 GTTAGGAACTGCAAATGCCATGG - Intergenic
1089797459 11:120993356-120993378 GCTAGGAACTTCCAGAGCAAAGG - Intergenic
1091563512 12:1631308-1631330 TCTGGAAACTGTCAGTCCCAGGG + Exonic
1092318362 12:7443410-7443432 TCTATGAAGTGCAAGTGCAAAGG + Intronic
1096456310 12:51790177-51790199 TCTAAGATCTTCCAGTCCCAAGG - Intronic
1098839029 12:75456696-75456718 CCTTGCAACTGGCAGTGCCAAGG + Intergenic
1100048572 12:90414911-90414933 TACAGGAATTGCCAGTGCCAAGG + Intergenic
1101471781 12:105003998-105004020 TATAGGAACTACAAGTACCAAGG + Intronic
1102179607 12:110902444-110902466 TCCAGGAACAGCCTGTGCAAAGG - Intronic
1104581378 12:130013637-130013659 CTTAGGAACTGACAGTGCTATGG - Intergenic
1107043279 13:35970946-35970968 CCTATGAACAGCCAGGGCCATGG + Intronic
1107087363 13:36440203-36440225 TCTAGGAACTTCCAGTGCCAAGG + Intronic
1107204603 13:37768317-37768339 TCTAGGAATTGACAGTGTGAAGG + Intronic
1108485353 13:50918027-50918049 TCTAGGAACAGCCTGTGCACTGG - Intronic
1118679860 14:68229625-68229647 TCTAGTTACTCCCAGTGCCCTGG - Intronic
1119028042 14:71169362-71169384 TCTGGGAGCTGTCTGTGCCACGG + Intergenic
1119372771 14:74161770-74161792 TGTAAGGACTGCCATTGCCAAGG + Intronic
1119791670 14:77355754-77355776 CATAGGAACTGCCACTTCCAAGG - Intronic
1120405812 14:84091981-84092003 CCTAGGAACTCCCTGAGCCAGGG + Intergenic
1121089616 14:91171960-91171982 TCTAGGGACTGCAAGGGCCATGG - Intronic
1121424524 14:93840082-93840104 TTTAGGAACTGGCATTTCCATGG + Intergenic
1121937500 14:98033757-98033779 TCTAGGAAATGGCATTGCTAAGG - Intergenic
1121956591 14:98218956-98218978 CCTAGAAAGTGCTAGTGCCAAGG + Intergenic
1122131355 14:99605816-99605838 AGCAGGAACAGCCAGTGCCAAGG + Intergenic
1122231874 14:100310204-100310226 CAGAGGAGCTGCCAGTGCCAAGG - Intergenic
1125335634 15:38623599-38623621 TTTATGGAATGCCAGTGCCAGGG - Intergenic
1126732103 15:51694339-51694361 TCTTGGAACAGCCAGTCTCAGGG + Intronic
1127714212 15:61632585-61632607 TCTAGGAAATGGCAGTGTCAAGG - Intergenic
1127775601 15:62262041-62262063 GCTAGGAGCACCCAGTGCCAAGG - Intergenic
1131663523 15:94544478-94544500 TGTAGCATCTGCCAGAGCCAGGG - Intergenic
1132090421 15:98943731-98943753 TCTAGAAGGTGCCTGTGCCAGGG - Intronic
1132856327 16:2046578-2046600 TCTAGCAACAGCCTGTACCAAGG + Intronic
1133288403 16:4702054-4702076 TCCAGGACCTGCCTGAGCCACGG + Intronic
1135541352 16:23332671-23332693 TATAGGCATTGCCAGGGCCAGGG + Intronic
1135692091 16:24547150-24547172 TCTAGAATTTGCCAGTGCTAGGG + Intronic
1135797240 16:25457267-25457289 TCTAGGAATTGACAGTACCTGGG + Intergenic
1135806259 16:25545570-25545592 TCTTGGACCTGCCTGTTCCATGG - Intergenic
1135976264 16:27110511-27110533 GCTAGGAAGTGGCAGTGCCCCGG + Intergenic
1136862154 16:33710825-33710847 TCAGGGCACGGCCAGTGCCAGGG - Intergenic
1140140535 16:72252452-72252474 TGAAGGAACAGCCAGTGCAAAGG + Intergenic
1141259369 16:82438800-82438822 TCTAGGAACGCCAAGGGCCAAGG - Intergenic
1203123649 16_KI270728v1_random:1559008-1559030 TCAGGGCACAGCCAGTGCCAGGG - Intergenic
1144434683 17:15229974-15229996 TCTAGGAACTCACGGTCCCAAGG + Exonic
1146840971 17:36153924-36153946 TCTAGGTGCAGGCAGTGCCAGGG + Intergenic
1147120462 17:38332475-38332497 TCTAAGACCTGCCAGGTCCAGGG + Intronic
1147671781 17:42180728-42180750 TCTAGGAACTCCCAAAGCCGCGG - Intronic
1148028810 17:44606208-44606230 TCTAGGAACGCCCAGTGTGATGG - Intergenic
1148194178 17:45701430-45701452 TCTAGGAATTGCCTCAGCCAAGG + Intergenic
1148659352 17:49315710-49315732 TCCGGTAACTGCCAGTGCCCTGG - Intronic
1149306734 17:55355134-55355156 ACTAGGAAGTGGCAGAGCCAGGG - Intergenic
1151015022 17:70543959-70543981 TCTAGGAACTGCAAGAGCCATGG - Intergenic
1154234477 18:12591246-12591268 AAAAGGAACTGCCAGTGCAAAGG + Intronic
1155530909 18:26765532-26765554 AGAAGGAACAGCCAGTGCCAAGG + Intergenic
1157395433 18:47337269-47337291 TCTAGGTACTGCCACTGTCACGG + Intergenic
1157888402 18:51390924-51390946 TTTAGGAAGTGCTAGTGTCAAGG - Intergenic
1158217370 18:55113971-55113993 GCAAGGAACTGCCAGTCCAAGGG + Intergenic
1158223211 18:55170918-55170940 TCCAGGAAGTGCCAGCTCCAAGG - Intergenic
1158355153 18:56610112-56610134 TCTAGGAATTGCCAGGCCTAAGG + Intronic
1158876805 18:61741949-61741971 GCTAGAAACTGGCAGAGCCAGGG + Intergenic
1159005297 18:63005257-63005279 TCTTGGAATCGCCAGTGCCCTGG - Intergenic
1159731019 18:72028057-72028079 GCTAGGAACTTCCAGTACTATGG + Intergenic
1160083497 18:75753285-75753307 TCTAGGAGCTCCCTGAGCCAGGG - Intergenic
1163477825 19:17537276-17537298 TCGAGCAACTGCCCATGCCAGGG + Intronic
1163752254 19:19084757-19084779 TAAAGGAACAGCCAGTTCCAGGG - Intronic
1164559265 19:29277397-29277419 TCTAGGAACTGCCTGTCCCTGGG + Intergenic
1165332769 19:35150611-35150633 TGCAGGAACAGCCAGTGCAAAGG + Intronic
1165958734 19:39517621-39517643 TGAGGGAACTGCCAGTGCAAAGG + Intronic
1166799675 19:45448870-45448892 CCCAGAAACAGCCAGTGCCATGG + Intronic
1168275713 19:55277242-55277264 AGTAGGAACAGCCAGTGCAAAGG - Intronic
925718889 2:6809422-6809444 ACAAGGCACTGACAGTGCCATGG - Intergenic
926746229 2:16160685-16160707 GCAAGGAATTCCCAGTGCCAGGG + Intergenic
926961507 2:18363222-18363244 TGTATGAACAACCAGTGCCATGG + Intergenic
927299722 2:21498011-21498033 TCTAGAAAGGGTCAGTGCCATGG - Intergenic
927712820 2:25336297-25336319 GCAAGGGGCTGCCAGTGCCAGGG - Intronic
928151967 2:28839202-28839224 GCTAGCAAGTGGCAGTGCCAGGG + Intronic
928614646 2:33024988-33025010 TCTGCCAACAGCCAGTGCCAGGG - Intronic
932653790 2:73589401-73589423 TCTTTTAACTTCCAGTGCCAAGG + Intronic
935275147 2:101469916-101469938 TCTTGGAACTGCCAGGATCAAGG - Intronic
935363494 2:102267281-102267303 GCAAGGAACTGTCAGGGCCATGG - Intergenic
941050916 2:160733014-160733036 ACTTGAAACTGCCAGTGCAAAGG + Intergenic
943827565 2:192414733-192414755 CCTAGGAACTTCCGGAGCCAGGG + Intergenic
945200458 2:207275788-207275810 GCTAGGAACTGCCCCTGCCTAGG + Intergenic
946052808 2:216878283-216878305 GGAAGGAACTGCCACTGCCAAGG - Intergenic
946225816 2:218263525-218263547 CCTAGGAAGTGCCAGTGCAGCGG + Exonic
947394807 2:229675899-229675921 TCCAGGAAGTACCACTGCCAGGG + Intronic
947752824 2:232541617-232541639 TCTAGGTGCTGCCAGAGCCAAGG - Intronic
948374499 2:237512524-237512546 ACTAGGAACGGCCGGTGACATGG + Intronic
1169011874 20:2257782-2257804 TCTAGGAACTGCAAGGGAAACGG + Intergenic
1170552476 20:17489639-17489661 GGAAGGAACTGCCACTGCCAGGG + Intergenic
1171142187 20:22752946-22752968 TCTAGCACCTTCCAGTGCCATGG - Intergenic
1171991559 20:31700456-31700478 TGTAGGATCTTCAAGTGCCAGGG - Intronic
1172291469 20:33780194-33780216 AACAGGAACAGCCAGTGCCAAGG + Intronic
1172438265 20:34945905-34945927 GCCAGGAGCTGCCAGAGCCAAGG - Intronic
1173144663 20:40514243-40514265 TCTGGAAACTGCCTGTGCAAAGG - Intergenic
1175609950 20:60342544-60342566 GATAGGAAATGCAAGTGCCAAGG - Intergenic
1177568768 21:22858826-22858848 TCTAGGTTTTGGCAGTGCCAAGG + Intergenic
1178502637 21:33138458-33138480 TGTAGGAACTGCAAATACCATGG - Intergenic
1179413558 21:41180176-41180198 TCTGGGTGCTGCCAGAGCCATGG + Intronic
1180141862 21:45897994-45898016 TCTAGGATGTGCCAGTGCTGTGG - Intronic
1180187957 21:46149774-46149796 TCCATGAGCTGCCAGTTCCAGGG + Intronic
1181043704 22:20204778-20204800 CCTAGGACCTGCCAGGTCCACGG + Intergenic
1181311743 22:21948647-21948669 CCCAGCAACTGCCAGTGCCTGGG + Intronic
1183268225 22:36844119-36844141 TCTAGCACCCACCAGTGCCAGGG - Intergenic
1184541057 22:45125258-45125280 TCTATGCACTGCCTGTGTCAGGG + Intergenic
949764734 3:7513842-7513864 TCTTTGAACTTCCAGTGCAAAGG + Intronic
954316980 3:49806545-49806567 TGTATGTACTGCCAGTGCCTTGG + Intronic
954415937 3:50393372-50393394 TCAAGGAAGCCCCAGTGCCAAGG - Intronic
955017818 3:55088953-55088975 CAGAGGAACAGCCAGTGCCAAGG - Intergenic
955996645 3:64686107-64686129 TGAAGGAACTCCCAGTGCCTTGG + Intronic
956909124 3:73798974-73798996 GCTAGTAAGTGGCAGTGCCAGGG - Intergenic
957636422 3:82791237-82791259 CCTAGGAGCTCCCAGAGCCAGGG + Intergenic
957674079 3:83344837-83344859 ACTAGCAAATCCCAGTGCCATGG - Intergenic
958977489 3:100683349-100683371 CCTAGGAACTCCCTGAGCCAGGG + Intronic
962686439 3:137852503-137852525 TCCCGGAGCTGCCAGTGCCAGGG - Intergenic
964008050 3:151854717-151854739 TCCAGTAAATCCCAGTGCCATGG + Intergenic
964075100 3:152683960-152683982 CCTAGGAACTCCCTGAGCCAGGG - Intergenic
964338144 3:155679366-155679388 GGTAGGTACTGCCATTGCCAGGG - Intronic
964645121 3:158950756-158950778 TCTGGGAAATCCTAGTGCCATGG - Intergenic
965929176 3:174021638-174021660 TCTGGGAACTGCCAGTCACGTGG + Intronic
965984573 3:174736157-174736179 CCTAGGAACTCCCTGAGCCAGGG - Intronic
968526321 4:1059438-1059460 TCTAGGAACTGGCTGTCCCTAGG - Intronic
969097935 4:4748113-4748135 TCTTGCCACTGCCAGAGCCAGGG + Intergenic
973041243 4:45472461-45472483 TCTGGGAACTCCCTGAGCCAGGG + Intergenic
975371547 4:73594462-73594484 ACTAGGAAGTGGCAGAGCCAGGG - Intronic
981186878 4:141814644-141814666 CTTAGGAACTGCTACTGCCAAGG - Intergenic
984021294 4:174487391-174487413 TCAGGGTACTACCAGTGCCAAGG - Intergenic
985392488 4:189504825-189504847 TCTAGGCCCTCCCAGTGCCGTGG - Intergenic
985958573 5:3282572-3282594 TCCAGGAACTGCAAATGCCCAGG + Intergenic
986534800 5:8775929-8775951 CATCGGAACTGACAGTGCCATGG + Intergenic
986964405 5:13253274-13253296 TCTGAGAATTGCCAATGCCATGG + Intergenic
989265569 5:39469877-39469899 TCTAGGATCTGCCTATTCCAGGG - Intergenic
990146455 5:52766444-52766466 TCAAGGAACTGCCTATGCTAAGG + Intergenic
992271779 5:75071861-75071883 TCTAGGAACTGCCAGTGCCATGG - Intronic
992301559 5:75387231-75387253 TCTAGGAACTGCCAGTGCCATGG - Intronic
992890651 5:81201050-81201072 TCTAGGAACAGCCATTGGGAAGG - Intronic
994232817 5:97328649-97328671 TCAAGGAACTTTCAGTACCAAGG + Intergenic
996234106 5:121106764-121106786 TCTAGTCACTGGCAATGCCAAGG + Intergenic
996234116 5:121106833-121106855 TCTACCCACTGGCAGTGCCAAGG + Intergenic
996234125 5:121106902-121106924 TCTAGTCACTGGCAGTGCCCAGG + Intergenic
997103498 5:130993991-130994013 TTTTGGAACTGCCAGTGTTAAGG - Intergenic
997467259 5:134096433-134096455 TCTAGGAGCTGTCTCTGCCAGGG + Intergenic
998215057 5:140231706-140231728 TGTAGGAACAGCAGGTGCCAAGG + Intronic
1002060955 5:176625751-176625773 TGTAGGAACAGCAAGTACCAAGG - Intronic
1004285594 6:14317950-14317972 TCAAGGAACTGACATTGTCATGG + Intergenic
1005852293 6:29830548-29830570 TCTAGGCAGTGACAGTGCCCAGG + Intronic
1006310141 6:33251595-33251617 TCCAGGAACTACCAAAGCCACGG + Exonic
1007711810 6:43829049-43829071 TCTAGACACTGTCAGGGCCAAGG - Intergenic
1007996273 6:46311537-46311559 TGGAAGAACTGCAAGTGCCAAGG + Intronic
1008422014 6:51312083-51312105 ACTAGGAAATTCCAGTCCCATGG - Intergenic
1009439766 6:63663393-63663415 ACAAGGATCTGCCACTGCCAAGG - Intronic
1011498954 6:87966805-87966827 TCTAGTGACTGCCTGTGCAATGG - Intergenic
1012269805 6:97194611-97194633 TCTATGAACTGCTAGTTGCATGG - Intronic
1012445553 6:99303787-99303809 TCTAAGAGGTGCCTGTGCCATGG + Intronic
1012566308 6:100658612-100658634 TTTAAGAAATGCCTGTGCCAAGG - Intronic
1016732860 6:147444961-147444983 TCTAGAAATTGCCAGAACCAAGG - Intergenic
1017697771 6:157035744-157035766 ACCAGGCTCTGCCAGTGCCAGGG + Intronic
1021279839 7:18704080-18704102 TCTAGCAAATGCCAGTTACATGG - Intronic
1021431052 7:20559677-20559699 TCTAGGAGCTCCCCGAGCCAGGG - Intergenic
1022235751 7:28458838-28458860 TATGGGAACTGCCATTTCCAAGG - Intronic
1023496306 7:40800966-40800988 GCCAGGAAGTGCCACTGCCAGGG + Intronic
1024229350 7:47352587-47352609 TCCAGGAACAGCCAGCGCCCTGG - Intronic
1027894724 7:84025838-84025860 ACTAGTAACTGGCAGAGCCAGGG + Intronic
1029293167 7:99518100-99518122 CCCAGGTAATGCCAGTGCCACGG - Intronic
1030779693 7:113584954-113584976 TCTGGGAACTCCCAGGGCCCTGG - Intergenic
1032325492 7:130924892-130924914 TGTAAGAACTGCTAATGCCAGGG + Intergenic
1034188955 7:149198979-149199001 TCTAGGAACAGCGAGAGCAAAGG - Intronic
1034559669 7:151872005-151872027 TGCAGGGACTGCCACTGCCAAGG - Intronic
1034941486 7:155233395-155233417 TCTAGGAAGTTCCAGTGGGAAGG + Intergenic
1035289378 7:157827830-157827852 TCTGGGAACAGCCCGTGACACGG - Intronic
1036633739 8:10533091-10533113 TCTGGGAACTGCCAGTGCAAGGG + Intronic
1041146287 8:54879990-54880012 TCTATTAACTGACAGTGACACGG - Intergenic
1041950180 8:63492395-63492417 TAGAGAAACTGCCAGTGCCAAGG + Intergenic
1043195629 8:77288257-77288279 CCTAGGAGCTGCCTGAGCCAGGG + Intergenic
1043392289 8:79803513-79803535 TCTAGAAACTGCAAGGGACAAGG - Intergenic
1044673177 8:94703641-94703663 TCTAATAACTGACAGTCCCAGGG + Intronic
1045004150 8:97902769-97902791 TCTCAGAAGTGCCAGGGCCAGGG + Intronic
1045713383 8:105012671-105012693 TCTAGGAGCTTCCAGTCCAATGG + Intronic
1047759163 8:127941327-127941349 TCTAGGAAGTTCTATTGCCATGG + Intergenic
1049802840 8:144526256-144526278 TCTGGGAACTGCCTCTGCCTGGG - Exonic
1052552469 9:29969222-29969244 CCTAGGAACTCCCTGAGCCAGGG - Intergenic
1053484819 9:38443997-38444019 TTTAGGAAATGCCAGAGCCGAGG + Intergenic
1056189669 9:84172673-84172695 GCGAGGAACTGCAAGTGCCTAGG - Intergenic
1057289098 9:93789068-93789090 TCTAGGCACACCCTGTGCCAGGG - Intergenic
1059318369 9:113446614-113446636 TCGAGGAACTACCAGTCCCCTGG - Intronic
1059443862 9:114326147-114326169 GCTGGGAAGTGACAGTGCCAGGG + Intronic
1059445068 9:114332924-114332946 GCTGGGAAGTGACAGTGCCAGGG + Intronic
1187597550 X:20790296-20790318 GCTAGGAACTGCCAGTTGAAAGG - Intergenic
1189119053 X:38374324-38374346 ACTAGAAGCTGCCATTGCCAAGG - Intronic
1193468660 X:81874779-81874801 CCTTGGAACTGCCTGAGCCAGGG - Intergenic
1195411383 X:104570353-104570375 ACTTGGAGCTGCAAGTGCCAAGG + Intronic
1197127242 X:122961001-122961023 TCTAGTAACTAGCAGAGCCAAGG - Intergenic
1202299241 Y:23393949-23393971 GCTAGGATTTTCCAGTGCCAAGG - Intergenic
1202571568 Y:26276649-26276671 GCTAGGATTTTCCAGTGCCAAGG + Intergenic
1202583839 Y:26405308-26405330 TCAGGGAAGGGCCAGTGCCAGGG + Intergenic