ID: 992305749

View in Genome Browser
Species Human (GRCh38)
Location 5:75435779-75435801
Sequence CCTGCTGTACTGGAGGGATA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 135}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992305743_992305749 -7 Left 992305743 5:75435763-75435785 CCCTAGAGGTTAAGCACCTGCTG 0: 1
1: 5
2: 28
3: 78
4: 190
Right 992305749 5:75435779-75435801 CCTGCTGTACTGGAGGGATAAGG 0: 1
1: 0
2: 0
3: 7
4: 135
992305744_992305749 -8 Left 992305744 5:75435764-75435786 CCTAGAGGTTAAGCACCTGCTGT 0: 1
1: 4
2: 24
3: 57
4: 264
Right 992305749 5:75435779-75435801 CCTGCTGTACTGGAGGGATAAGG 0: 1
1: 0
2: 0
3: 7
4: 135
992305740_992305749 11 Left 992305740 5:75435745-75435767 CCAGGATTACTGTCTGGCCCCTA 0: 1
1: 0
2: 2
3: 11
4: 130
Right 992305749 5:75435779-75435801 CCTGCTGTACTGGAGGGATAAGG 0: 1
1: 0
2: 0
3: 7
4: 135
992305742_992305749 -6 Left 992305742 5:75435762-75435784 CCCCTAGAGGTTAAGCACCTGCT 0: 1
1: 8
2: 31
3: 87
4: 221
Right 992305749 5:75435779-75435801 CCTGCTGTACTGGAGGGATAAGG 0: 1
1: 0
2: 0
3: 7
4: 135
992305738_992305749 26 Left 992305738 5:75435730-75435752 CCTGGGGGGCTGAGACCAGGATT 0: 1
1: 0
2: 0
3: 23
4: 226
Right 992305749 5:75435779-75435801 CCTGCTGTACTGGAGGGATAAGG 0: 1
1: 0
2: 0
3: 7
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992305749 Original CRISPR CCTGCTGTACTGGAGGGATA AGG Intronic
900390297 1:2430920-2430942 CCTGCTGCACTGGGGGGGTCTGG + Intronic
900531516 1:3155827-3155849 CCTGCTGCTCTGGAGGGTCAGGG - Intronic
901907721 1:12428694-12428716 CCTGCTGTAATGGAAGCACACGG - Intronic
902700312 1:18167760-18167782 CCTGCTGTACAGGGGAGAGAAGG + Intronic
902888924 1:19427233-19427255 CCTGCTGTAGTGGCTGGTTAAGG + Intronic
903008707 1:20315432-20315454 CCTGGTGTACAGGAGGGAAAAGG + Intronic
907298136 1:53468692-53468714 CCTGCTGTACTGGCAGGTCAGGG - Intergenic
907771172 1:57465706-57465728 CCTGGTGTGCTAGTGGGATATGG - Intronic
907811268 1:57872677-57872699 GCTGCTGTACCAGAGGGGTATGG + Intronic
909113007 1:71503580-71503602 CCTGCTGTGTGGAAGGGATAGGG - Intronic
909534826 1:76724864-76724886 CCTCCTGTACTGGAAGGTTATGG + Intergenic
910749799 1:90616649-90616671 CCAGCTGTAATGGTGAGATAAGG + Intergenic
911144409 1:94538813-94538835 GCTGCTGTACTGGAGGGCCTGGG - Intronic
918475397 1:184918776-184918798 GCTGCTATACTGGAGAGAGAGGG - Intronic
920797634 1:209155847-209155869 CCTGCTTTTCTTAAGGGATATGG - Intergenic
921626826 1:217386397-217386419 CCTGCTGTTCAGGAGAGAAAGGG - Intergenic
923479879 1:234373878-234373900 CCCGCTTTACTGGTGGGAAACGG + Intronic
924468151 1:244316249-244316271 CCTGCTGTCTTGCAGGGACATGG + Intergenic
924495614 1:244585707-244585729 CCTGCTGGACCGAAGGGACATGG + Intronic
924740779 1:246793323-246793345 GCTGCTGGACTGGAGGGGGAGGG + Intergenic
924788163 1:247219563-247219585 CCTGCTGTGTGGAAGGGATAGGG - Intergenic
924805042 1:247355241-247355263 CCTGCTGTGTGGAAGGGATAGGG - Intergenic
1063376032 10:5554973-5554995 CCTGCTGAAGTGGAGAGAAAAGG + Intergenic
1068203143 10:53810599-53810621 CCAGCTGGACAGGAGGAATATGG - Intronic
1071235864 10:83647337-83647359 CCTGCTGTGCTGGAGGGCCAGGG - Intergenic
1072898030 10:99383827-99383849 GCTGCTGTACTGGATGGTGAAGG - Intronic
1073393783 10:103201267-103201289 ACTGCTCTGGTGGAGGGATATGG - Intergenic
1074859014 10:117496196-117496218 CCTGCGGTGCTGGGGGGAGAGGG - Intergenic
1077124052 11:924792-924814 CCTGCTGCAGTGGGGGGATCTGG - Intergenic
1084024923 11:66441943-66441965 CCTGCTGTGTGGAAGGGATAGGG + Intronic
1085083454 11:73651722-73651744 CCTGCTTTACTGGGGGGACCTGG + Intronic
1086574588 11:88324669-88324691 CATGCTGTAATGGAGTGATTGGG - Intronic
1086824271 11:91475831-91475853 CCTGCTGTGCTGGAGGGGCTGGG - Intergenic
1087607627 11:100395526-100395548 CCTACTGTATTGGAGGTCTAGGG - Intergenic
1089879824 11:121762883-121762905 GCTGCTGCACTGGAGGGAGTCGG + Intergenic
1090652127 11:128816008-128816030 ACTGCTGTACAGGAGGTTTATGG + Intergenic
1092065021 12:5582899-5582921 CCTGCAGTGCTGGTGGGAAATGG - Intronic
1093005485 12:14046439-14046461 CCTGCTATACTTGAAGGAAATGG + Intergenic
1094590642 12:31816557-31816579 CCTGCTGTACTGCAATGAGATGG + Intergenic
1095345372 12:41143296-41143318 CCTGCTGTATTGGAATGAGAAGG + Intergenic
1095751855 12:45721403-45721425 CCTACTGAACTGAAGGGAAAGGG - Intergenic
1103997837 12:124841649-124841671 CCTGCTGTGTTGGAGGAAGAGGG - Intronic
1106407178 13:29484299-29484321 CCTGCTCTGCAGGAGGGCTAAGG - Intronic
1106904334 13:34389219-34389241 CCTGCTCCTCTGGAGTGATACGG + Intergenic
1107150487 13:37105408-37105430 CCTGGTGTGCTGCAGGGATCAGG - Exonic
1112814538 13:103256417-103256439 CCAGCTTTACTGGAGTGAGAAGG - Intergenic
1112940511 13:104855519-104855541 ACTCCTGTTCTTGAGGGATAGGG + Intergenic
1115418453 14:33164874-33164896 CCTTCTGTACTGGTGAGACAGGG + Intronic
1118639866 14:67782354-67782376 CATGCTGTACTGGAGGGGCTGGG + Intronic
1119423010 14:74518784-74518806 CCTGCTGTACTGGTGGGCCCAGG + Intronic
1121023186 14:90594314-90594336 CCTGCTGTCCTGAAAGGCTAAGG + Intronic
1121808805 14:96859406-96859428 TCTGTTATACTGAAGGGATATGG + Intronic
1121858148 14:97289621-97289643 CCTGCTGTCCTGGAAGCATTTGG + Intergenic
1122911055 14:104827722-104827744 CCTGCAGTCCTGGAGGGGCAGGG + Intergenic
1123121724 14:105919840-105919862 CCTGCATTGCTGGAGGGACAGGG - Intronic
1123404429 15:20011491-20011513 CCTGCATTGCTGGAGGGACAGGG - Intergenic
1123513762 15:21018138-21018160 CCTGCATTGCTGGAGGGACAGGG - Intergenic
1132640563 16:976392-976414 ACAGCTGTACTGCAGGGTTAGGG + Intronic
1134029880 16:10983439-10983461 GCTGCTGTTCTGCAGGAATATGG + Intronic
1135565146 16:23506273-23506295 GGTGCTGCAATGGAGGGATAAGG - Intronic
1141809650 16:86367030-86367052 CCTATTGTAATGAAGGGATAAGG - Intergenic
1143232920 17:5372723-5372745 CCTTCTGTAGTACAGGGATATGG + Intronic
1143759053 17:9088072-9088094 ACTGCTGTGCTGGAAGGAGAAGG + Intronic
1143943162 17:10564436-10564458 CCTGCTGTCCAAGAGGGATCTGG + Intergenic
1144524374 17:15977905-15977927 CCTGCAGTCCTGGAGGGAAAAGG + Exonic
1146555321 17:33818112-33818134 CCTCCTGGAGTTGAGGGATAAGG + Intronic
1150271598 17:63869527-63869549 GCTGTTGTACTGGTGGAATAGGG - Intergenic
1150835880 17:68563960-68563982 CCTGCTGTAATGAAGTGAGAGGG + Intronic
1152001130 17:77645933-77645955 CCTGCTGTACTGGAGCCTTTAGG - Intergenic
1152035262 17:77868332-77868354 CCTCCTGAACTGGAGGGCTGGGG - Intergenic
1162349842 19:10142147-10142169 CCTGCTCTACTGGAGCGACGAGG - Exonic
1165900119 19:39165583-39165605 CCTGCTGCCCTGGAGGGCTGAGG - Intronic
1167095005 19:47370573-47370595 CCTGCTGTGCTGCAAGGATGGGG - Intronic
926893666 2:17660716-17660738 GCTGCTGTTCTGAAGGGAAAAGG + Intergenic
929942873 2:46348121-46348143 CCTGTAGTACAGGAAGGATATGG + Intronic
930277958 2:49335744-49335766 CCTGCTCTGCTGGAGGAACAGGG + Intergenic
936492537 2:112984716-112984738 CCTGCTCTAATAGATGGATAAGG + Intronic
943777979 2:191788145-191788167 CCAGCTATACTGGAGGAAAAGGG + Intergenic
946999237 2:225434236-225434258 GCTGCTGTACTGGAGGGCAGAGG - Intronic
1176196144 20:63837020-63837042 CCCGCTGTGTTTGAGGGATACGG - Intergenic
1177133859 21:17290059-17290081 CCTGCTGCACTGGAGGGGCAAGG - Intergenic
1178244688 21:30939017-30939039 CCTTCTGTTCTTTAGGGATAGGG - Intergenic
1178405133 21:32317367-32317389 CCTCCTGTAGTGCAGGGTTAAGG - Intronic
1178619597 21:34161988-34162010 CCTGGGGTACTTGAGGGAGAAGG + Intergenic
1182874463 22:33678998-33679020 CCTGCTGAATTGAAGGGATCCGG - Intronic
1183273930 22:36879455-36879477 CCTGCTCTACCAGAGGGTTAAGG - Intergenic
1184951330 22:47844521-47844543 CCTCCTGTGCAGGAGGGACAGGG + Intergenic
949363828 3:3259466-3259488 CCTGTTCTCCTGCAGGGATAAGG + Intergenic
949555419 3:5148337-5148359 CCTGCTGTGTGGAAGGGATAGGG + Intronic
952711949 3:36440407-36440429 CCTGCTGTCCTGCAGGCATAAGG - Intronic
952933616 3:38378379-38378401 CCTGCTGTCTAGGAGGGAGAGGG + Intronic
953811582 3:46117193-46117215 CTTGCTGTGCGGAAGGGATAGGG + Intergenic
954373876 3:50184242-50184264 CCAGCTGTGCAGGAGGGAGACGG + Intronic
954385526 3:50241970-50241992 CCTGCAGTGCTGGAGGCCTAGGG - Intronic
958615868 3:96493306-96493328 CTTGCTGCACTGGAGGGCCAAGG + Intergenic
959812011 3:110630369-110630391 CCAGTTGGACTGGAGGGATCAGG + Intergenic
961723411 3:128910414-128910436 CCCGCTGTGCTGGAGGGAGGCGG + Intronic
962179476 3:133190696-133190718 GCTGCTTTACTGAAGAGATATGG - Intronic
970591533 4:17564324-17564346 CCTCCTGGACTGGATGAATAAGG + Intergenic
975693979 4:76993501-76993523 AATGCTGGACTGGAGGGATGCGG + Intronic
976244114 4:82990377-82990399 CCTGCGGGACTTGGGGGATATGG - Intronic
977048809 4:92100929-92100951 CCTTCTGTACTGGAAGAAAAAGG - Intergenic
986066492 5:4239741-4239763 CCTGCTGTGTTGCAGGGATGAGG - Intergenic
987081957 5:14433360-14433382 CCTCCTGCTCTGGAGGGAAAGGG - Intronic
987290684 5:16505628-16505650 CCAGCTGTCCTGAAGGGAGAGGG - Intronic
988592964 5:32565039-32565061 CCAGCTGTACAGGAGGTATCAGG + Intronic
992305749 5:75435779-75435801 CCTGCTGTACTGGAGGGATAAGG + Intronic
997064888 5:130548597-130548619 CCTGCTGTATGGAAGGAATAGGG + Intergenic
998383543 5:141742737-141742759 CCTCCTGGAATGGAGGGATGAGG + Intergenic
998885592 5:146690804-146690826 CCTTCTGTACTGAAGGTACAGGG - Intronic
999718420 5:154380584-154380606 TCTGCAGTTCTGGAGGGATCGGG - Exonic
1001300698 5:170531674-170531696 CATGCTGTACTGTAGGGGAAAGG - Intronic
1001825615 5:174742809-174742831 CCTGCTCTCCTGGAGGGGTTGGG - Intergenic
1002777077 6:337481-337503 CCTGCTGACATGGAGGGACAGGG + Intronic
1006639631 6:35483324-35483346 CCTCCTGTCCTGGTGGGATTTGG - Intronic
1012432759 6:99183229-99183251 TCTGGTGTTCTAGAGGGATATGG + Intergenic
1014395049 6:120917174-120917196 CTGGATGTACTGGAGAGATAGGG + Intergenic
1017915171 6:158825989-158826011 TCTGCTGGACTGGAGGCACAGGG - Intergenic
1021662727 7:22936389-22936411 GCGGCTATACTGGAAGGATAGGG - Intergenic
1022799461 7:33761838-33761860 CCCGCTGTGCTGGAGGCAAATGG + Intergenic
1023619872 7:42059854-42059876 CCTGCTCCACTGGAGGAAAAGGG - Intronic
1032574059 7:133033860-133033882 CCTGATGTCCTAGAGGGATGAGG + Intronic
1034205265 7:149309124-149309146 CCTGCTGTACTGTAGGCCTTGGG + Intergenic
1034269972 7:149798699-149798721 CCTGCTGTCCTGCGGGGATGAGG + Intergenic
1034315783 7:150131643-150131665 CCTGATGAACTAGAGGGAGAAGG - Intergenic
1034791106 7:153969158-153969180 CCTGATGAACTAGAGGGAGAAGG + Intronic
1034846557 7:154451539-154451561 GCTGCTGTGCTGGAGGGAGGAGG - Intronic
1035006100 7:155662331-155662353 GCTGCTGTGCTGGAGAGAAATGG - Intronic
1037480820 8:19303564-19303586 CCTAATGTTCTGGAGGGAGATGG + Intergenic
1039970711 8:42319598-42319620 GCTGCTGGCCTGGAGGGAAATGG + Exonic
1040750352 8:50698461-50698483 CCTCCTGTACTGGTGGGGGAAGG + Intronic
1046709376 8:117492592-117492614 CCTGTTGTGGTGGAGGGAGAGGG + Intergenic
1046719357 8:117601576-117601598 GATGGTATACTGGAGGGATATGG - Intergenic
1051681323 9:19610935-19610957 CCTGCTCTGTTGGAGGAATAAGG + Intronic
1055779890 9:79808987-79809009 CCTGCTTTTGTGAAGGGATAGGG + Intergenic
1058842125 9:108920071-108920093 CCTCCTTTACTGAAGGGTTAAGG + Intronic
1059692786 9:116701685-116701707 ACTGCTTTACTTGAGGGAAAAGG - Intronic
1060739179 9:126086693-126086715 CCTGCTGTGCTTGAGGACTATGG - Intergenic
1060972144 9:127744468-127744490 CCTGCTGTACTTGGGGAATCTGG + Intronic
1062324517 9:136005698-136005720 CCCGCCGTACTGGAGGGAGGTGG - Intergenic
1186445968 X:9629043-9629065 CCTGCTCTACTTGTGGAATACGG + Intronic
1190534087 X:51408459-51408481 CCTGCTCTTCTGGAGGGACAGGG - Exonic
1200240348 X:154490112-154490134 CCAGCCCTACTGGAGGGATGGGG - Intronic