ID: 992306626

View in Genome Browser
Species Human (GRCh38)
Location 5:75446891-75446913
Sequence GTGATTTCTAGGAGACTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 177}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992306626_992306630 -9 Left 992306626 5:75446891-75446913 CCTTCAAGTCTCCTAGAAATCAC 0: 1
1: 0
2: 1
3: 13
4: 177
Right 992306630 5:75446905-75446927 AGAAATCACTACAGCCAGAGGGG 0: 1
1: 0
2: 1
3: 38
4: 313
992306626_992306629 -10 Left 992306626 5:75446891-75446913 CCTTCAAGTCTCCTAGAAATCAC 0: 1
1: 0
2: 1
3: 13
4: 177
Right 992306629 5:75446904-75446926 TAGAAATCACTACAGCCAGAGGG 0: 1
1: 0
2: 2
3: 23
4: 217
992306626_992306635 13 Left 992306626 5:75446891-75446913 CCTTCAAGTCTCCTAGAAATCAC 0: 1
1: 0
2: 1
3: 13
4: 177
Right 992306635 5:75446927-75446949 GGAGGGACCTGCAACAATAATGG No data
992306626_992306633 -4 Left 992306626 5:75446891-75446913 CCTTCAAGTCTCCTAGAAATCAC 0: 1
1: 0
2: 1
3: 13
4: 177
Right 992306633 5:75446910-75446932 TCACTACAGCCAGAGGGGGAGGG No data
992306626_992306632 -5 Left 992306626 5:75446891-75446913 CCTTCAAGTCTCCTAGAAATCAC 0: 1
1: 0
2: 1
3: 13
4: 177
Right 992306632 5:75446909-75446931 ATCACTACAGCCAGAGGGGGAGG 0: 1
1: 0
2: 4
3: 20
4: 214
992306626_992306631 -8 Left 992306626 5:75446891-75446913 CCTTCAAGTCTCCTAGAAATCAC 0: 1
1: 0
2: 1
3: 13
4: 177
Right 992306631 5:75446906-75446928 GAAATCACTACAGCCAGAGGGGG 0: 1
1: 0
2: 7
3: 32
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992306626 Original CRISPR GTGATTTCTAGGAGACTTGA AGG (reversed) Intronic