ID: 992306631

View in Genome Browser
Species Human (GRCh38)
Location 5:75446906-75446928
Sequence GAAATCACTACAGCCAGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 7, 3: 32, 4: 183}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992306626_992306631 -8 Left 992306626 5:75446891-75446913 CCTTCAAGTCTCCTAGAAATCAC 0: 1
1: 0
2: 1
3: 13
4: 177
Right 992306631 5:75446906-75446928 GAAATCACTACAGCCAGAGGGGG 0: 1
1: 0
2: 7
3: 32
4: 183
992306625_992306631 -7 Left 992306625 5:75446890-75446912 CCCTTCAAGTCTCCTAGAAATCA No data
Right 992306631 5:75446906-75446928 GAAATCACTACAGCCAGAGGGGG 0: 1
1: 0
2: 7
3: 32
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992306631 Original CRISPR GAAATCACTACAGCCAGAGG GGG Intronic