ID: 992314606

View in Genome Browser
Species Human (GRCh38)
Location 5:75539583-75539605
Sequence GAGTATCTCTGAAGCCTAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 493
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 470}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992314606_992314612 21 Left 992314606 5:75539583-75539605 CCTACTAGGCTTCAGAGATACTC 0: 1
1: 0
2: 0
3: 22
4: 470
Right 992314612 5:75539627-75539649 AATTTTTTTTTTATAGAGACAGG 0: 17
1: 217
2: 1885
3: 11492
4: 51150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992314606 Original CRISPR GAGTATCTCTGAAGCCTAGT AGG (reversed) Intronic
900015974 1:150239-150261 GAGCATCTCTTGAGCCCAGTTGG - Intergenic
900046237 1:508836-508858 GAGCATCTCTTGAGCCCAGTTGG - Intergenic
900068439 1:750548-750570 GAGCATCTCTTGAGCCCAGTTGG - Intergenic
900629550 1:3626666-3626688 GAGGATCACTTAAGCCTAGGAGG - Intronic
901408412 1:9065858-9065880 GAGTATCTCTTGAGCCCAGGAGG + Intronic
901437284 1:9255369-9255391 GAGGATCACTTAAGCCTAGGAGG - Intronic
902006520 1:13236598-13236620 GAGAATCTCTTAAGCCCAGGAGG + Intergenic
902025573 1:13380983-13381005 GAGAATCTCTTAAGCCCAGGAGG + Intergenic
902201603 1:14837640-14837662 GAGGATCTCTTGAGCCTAGGAGG - Intronic
902261461 1:15228105-15228127 GAGAATCGCTCAAGCCTAGGAGG - Intergenic
902448264 1:16481214-16481236 GAGGATCACTTAAGCCTAGGAGG + Intergenic
903096550 1:20981022-20981044 AAGTATCTTTGAGGCCTAGGTGG - Intronic
903105863 1:21079592-21079614 GAGTATCTCTTGAGCCTAAAAGG + Intronic
904109661 1:28115742-28115764 GAGAATCTCTGGAGCCCAGGAGG + Intergenic
907727770 1:57035930-57035952 GAGAATCACTGAAGCCTGGGAGG - Intronic
908366049 1:63424866-63424888 GAGAATCTCTTGAACCTAGTAGG - Intronic
910882689 1:91936740-91936762 GAGGATCTCTTAAGCCCAGGAGG + Intergenic
911062162 1:93757972-93757994 GGGGAGCTCTGAAGCCAAGTTGG + Intronic
912839132 1:113023507-113023529 GAGTATCCCTTGAGCCTAGGAGG - Intergenic
912862019 1:113222213-113222235 GAGGATCTCTGGAGCCTGGGAGG - Intergenic
912908919 1:113736653-113736675 GAGAATCACTTAAGCCTAGGAGG + Intronic
913281088 1:117185668-117185690 TATTCTCTCTGAAGCCTACTTGG + Intronic
914172495 1:145238898-145238920 GAGGATCTCTTGAGCCTAGGAGG - Intergenic
914235069 1:145801875-145801897 GAGAATCTCTGGAGCCTGGGAGG - Intronic
916765233 1:167853926-167853948 GAGTATCTCTTGAGCCTGGGAGG - Intronic
917819722 1:178750019-178750041 GAGGATCTCTGGAGCCTGGGAGG + Intronic
918482500 1:184993850-184993872 GAGGATCTCTTGAGCCTAGGAGG - Intergenic
919458457 1:197847358-197847380 GAGAATCTCTTGAGCCTAGGAGG + Intergenic
919575440 1:199303172-199303194 GAGAATCTCTTAAGCCCAGGAGG - Intergenic
919700955 1:200630372-200630394 GAGTAACTCTCAAGACAAGTAGG + Intronic
920619738 1:207532956-207532978 GAGTATCCCTTAAGCCTGGGAGG + Intronic
920620616 1:207542583-207542605 GAGTCTGACTGAGGCCTAGTAGG + Intronic
920621520 1:207551511-207551533 GAGTATCCCTTAAGCCTGGGAGG + Intronic
920622398 1:207561140-207561162 GAGTCTGACTGAGGCCTAGTAGG + Intronic
920623146 1:207568606-207568628 GAGTATCCCTTAAGCCTGGGAGG + Intronic
920776592 1:208944073-208944095 ATTTATCTCTGAAGACTAGTGGG + Intergenic
921007531 1:211109476-211109498 AAGTGTATATGAAGCCTAGTTGG + Intronic
921034833 1:211367069-211367091 GAGAATCTCTTGAGCCTAGGAGG - Intronic
921075989 1:211700437-211700459 GAGGATCTCTTGAGCCTAGAAGG + Intergenic
921096614 1:211892212-211892234 GAGGATCTCTTGAGCCTAGGAGG - Intergenic
922103799 1:222495934-222495956 GAGCATCTCTTGAGCCCAGTTGG - Intergenic
922115266 1:222607338-222607360 GAGAATCACTTAAGCCTAGGAGG + Intergenic
922264117 1:223968451-223968473 GAGCATCTCTTGAGCCCAGTTGG - Intergenic
922771057 1:228183130-228183152 GAGGATCACTTAAGCCTAGGAGG + Intergenic
922945527 1:229510703-229510725 GAGGATCACTGAAGCCCAGAAGG - Intergenic
924345964 1:243073443-243073465 GAGCATCTCTTGAGCCCAGTTGG - Intergenic
1063223647 10:3993958-3993980 AAATATATCTGAAGCCTGGTTGG + Intergenic
1063511738 10:6651558-6651580 GAGGATCACTTGAGCCTAGTTGG - Intergenic
1063845986 10:10127138-10127160 GAGAATCTCTTGAGCCTAGGAGG + Intergenic
1063921044 10:10933211-10933233 GAGGATCTCTTAAGCCCAGGAGG + Intergenic
1064228202 10:13506011-13506033 TTGTATCTCTGGAGCCTAGGAGG - Intronic
1064565224 10:16632853-16632875 GAGGATCTCTGAAGCCTGGGAGG + Intronic
1065081575 10:22134775-22134797 GAGGATGTCTTAAGCCTAGGAGG + Intergenic
1065165926 10:22976949-22976971 AAGAATCTCTGATGCCAAGTGGG - Intronic
1065214085 10:23433205-23433227 GAGGATCACTGAAGCCCAGAAGG + Intergenic
1066400298 10:35069449-35069471 GAGGATCTCTTGAGCCTAGGAGG + Intronic
1066590170 10:36986006-36986028 GAGGATCTCACAAGCCAAGTGGG + Intergenic
1066730378 10:38431372-38431394 GAGCATCTCTTGAGCCCAGTTGG + Intergenic
1068098508 10:52521938-52521960 GAGAATCACTTAAGCCTAGGAGG + Intergenic
1069401307 10:68049819-68049841 GAGGATCTCTTAAGCCTATGAGG + Intronic
1071219741 10:83451449-83451471 GAGTAACTCTGAAGTTTAATAGG + Intergenic
1071873665 10:89820681-89820703 GAGGATCACTTAAGCCTAGGAGG + Intergenic
1072128540 10:92469516-92469538 GAGGATCTCTTGAGCCTAGGAGG - Intronic
1072349058 10:94540131-94540153 CAGTATCACTGAAGCCGAATTGG - Intronic
1073097773 10:100990221-100990243 GAGGATCGCTTGAGCCTAGTAGG + Intronic
1073149831 10:101304156-101304178 GAGGATCGCTTAAGCCTAGGAGG - Intergenic
1073536631 10:104282462-104282484 GAGGATCACTGGAGCCTAGGAGG + Intronic
1073717274 10:106121587-106121609 GTGGATCTCTTGAGCCTAGTAGG + Intergenic
1075499723 10:122961908-122961930 GAGGATCTCTTAAGCCCAGGTGG + Intronic
1075729983 10:124630322-124630344 GAGGATCACTGAAGCCCAGGTGG + Intronic
1076267458 10:129119850-129119872 GGGTATCTCTGAACCTTGGTTGG - Intergenic
1076387262 10:130066275-130066297 GAGGATCTCTTGAGCCTAGGAGG - Intergenic
1076735009 10:132454978-132455000 GAGGATCTCTGGAGCCTGGAAGG - Intergenic
1076972565 11:145308-145330 GAGCATCTCTTGAGCCCAGTTGG - Intergenic
1077126056 11:937516-937538 GAGGATCTCTTGAGCCTAGGAGG + Intronic
1078176306 11:8973930-8973952 GTGTATACCAGAAGCCTAGTGGG - Intergenic
1079910744 11:26306572-26306594 GAGGATCACTGAAGCCTTGGAGG + Intergenic
1080389701 11:31833722-31833744 GGGCATCTCTGGGGCCTAGTCGG + Intronic
1080502179 11:32881221-32881243 GAGGATCTCTCAAGCCCAGGAGG + Intergenic
1080621814 11:33992957-33992979 GAGGATCACTGGAGCCTAGGAGG + Intergenic
1081918127 11:46747510-46747532 GAGAATCTCTTAAGCCTGGGAGG + Intronic
1082008332 11:47433651-47433673 GAGTATCACTTAAGCCCAGGAGG - Intergenic
1082193055 11:49270335-49270357 GAGGATCACTGGAGCCTAGGAGG - Intergenic
1082263317 11:50094729-50094751 GAGCATCTCTTGAGCCCAGTTGG - Intergenic
1082264871 11:50107608-50107630 GAGGATCACTGGAGCCTAGAAGG + Intergenic
1083177358 11:60959086-60959108 GAGGATCTCTTGAGCCTAGGTGG + Intergenic
1083557776 11:63645678-63645700 GAGGATCACTTAAGCCTAGGAGG - Intronic
1083701668 11:64483280-64483302 GAGAATCTCTTAAGCCTGGGAGG + Intergenic
1084401974 11:68949613-68949635 GAGGATCTCTGGAGCCCAGGAGG - Intergenic
1085075771 11:73590311-73590333 GAGGATCACTTCAGCCTAGTAGG + Intronic
1085188707 11:74599120-74599142 GAGTATCCCTTAAGCCTAGGAGG - Intronic
1085486676 11:76869949-76869971 GAGGATCACTTAAGCCTAGGAGG - Intronic
1085619443 11:78026677-78026699 GAGGATCTCTTGAGCCTAGGAGG + Intronic
1085716135 11:78875291-78875313 GAGAATCACTGGAGCCTAGGAGG - Intronic
1085897912 11:80662015-80662037 GAGGATCTCACAAGCCAAGTGGG - Intergenic
1086146590 11:83559226-83559248 CAGAATCTCTGGAGTCTAGTGGG + Intronic
1086673076 11:89570734-89570756 GAGGATCACTGGAGCCTAGGAGG + Intergenic
1086998952 11:93393175-93393197 GAGGATCCCTTAAGCCTAGGAGG - Intronic
1087775595 11:102253912-102253934 GAGGATCACTGGAGCCTAGGAGG - Intergenic
1088532271 11:110823323-110823345 GAGGATCTCTTGAGCCTAGGAGG + Intergenic
1088871226 11:113892213-113892235 GAGAATCACTTAAGCCCAGTAGG - Intergenic
1089048816 11:115528060-115528082 GCCTAGCTCTGAAGGCTAGTGGG + Intergenic
1089521092 11:119064077-119064099 GAGTATCTCGTGAGCCTAGGAGG + Intergenic
1089720125 11:120410036-120410058 AAGTTTCTCTGAAGCTTAATCGG + Intronic
1091017624 11:132067042-132067064 GAGGATCTCTTGAGCCTAGGAGG - Intronic
1091662369 12:2394013-2394035 GAGGATCTCTTGAGCCTAGGAGG + Intronic
1092156818 12:6288169-6288191 GAGGATCTCTTGAGCCTGGTAGG - Intergenic
1094578645 12:31712164-31712186 GAGGATCTCTTGAGCCTAGGAGG - Intronic
1095754241 12:45746198-45746220 GAGGATCTCTTAAGCCAAGAAGG - Intronic
1096528329 12:52227727-52227749 GAGGATCTCTTAAGCCCAGGAGG - Intergenic
1096989961 12:55792772-55792794 GAGTATCTCTTAAGCCTGGGAGG - Intronic
1097212383 12:57382202-57382224 GAGGATCTCTTGAGCCTAGGAGG - Intronic
1097869444 12:64588164-64588186 GAGGATCGCTTAAGCCAAGTAGG - Intergenic
1097882681 12:64700349-64700371 GAGGATCTCTTAAGCCCAGGAGG - Intergenic
1098326705 12:69311199-69311221 GAGGATCACTGGAGCCTAGGAGG - Intergenic
1099499578 12:83396851-83396873 GAGAATCTCTGAATCCTGGATGG - Intergenic
1099745720 12:86702109-86702131 GAGGATCTCTTAAGCCCAGGGGG - Intronic
1100347157 12:93743419-93743441 GAGGATCGCTTAAGCCTAGGAGG - Intronic
1101683358 12:106990523-106990545 GAGGATCACTGAAGCCCAGGAGG - Intergenic
1101738695 12:107483115-107483137 GAGGATCACTCAAGCCTAGGAGG - Intronic
1101815466 12:108142898-108142920 GAGTATCTCTTGAGCCTAGGAGG - Intronic
1102033125 12:109754755-109754777 GAGTATCACTGAAGCCCAGGAGG - Intronic
1102098863 12:110261904-110261926 GAGTATCTCTTGAGCCTGGGAGG + Intergenic
1102311657 12:111849804-111849826 GAGAATCACTTAAGCCTAGAAGG - Intronic
1102390303 12:112544281-112544303 GAGAATCTCTTAAGCCCAGGAGG - Intergenic
1102661697 12:114534557-114534579 GAGTATCTCTTGAGGCTGGTAGG - Intergenic
1102666045 12:114573777-114573799 GAGTATCTCTTGAGGCTCGTAGG + Intergenic
1102958540 12:117075752-117075774 GAGGATCTCTGGAGCCCAGGAGG - Intronic
1103430046 12:120876049-120876071 AAGTATCTGTGAAGTCAAGTTGG - Intronic
1104187198 12:126444245-126444267 GAGAATCGCTGAAACCTAGGAGG - Intergenic
1104729312 12:131096334-131096356 GAGGATCTCTGGAGCCCAGGAGG - Intronic
1105891622 13:24686348-24686370 GAGAATCTCTGAAACCCAGGAGG + Intronic
1105935387 13:25093854-25093876 GAGGATCTCTTAAGCCTGGGAGG + Intergenic
1107078874 13:36352868-36352890 GAGAATCTCTCAAGCCTGGGAGG + Intronic
1108544524 13:51479475-51479497 GAGGGTCTCTGAAGCAAAGTGGG - Intergenic
1112018867 13:95354216-95354238 GAGGATCGCTTAAGCCTAGTAGG + Intergenic
1112461195 13:99605335-99605357 GAGAATCACTCAAGCCTAGGAGG + Intergenic
1112547480 13:100385710-100385732 GAGGATCACTGGAGCCTAGGAGG - Intronic
1113538613 13:111088221-111088243 GAGGATCACTGGAGCCTAGCGGG + Intergenic
1114081862 14:19207870-19207892 GAGAATCTCTTGAGCCTAGGTGG + Intergenic
1115997855 14:39212140-39212162 GAGTGATTCTGAAGCCTACTCGG + Intergenic
1116259660 14:42608142-42608164 GAGAATCTCTTGAGCCTAGAAGG - Intergenic
1116849097 14:49891323-49891345 GAGGATCTCTTGAGCCTAGGAGG + Intergenic
1118368562 14:65116412-65116434 GAGGATCTCTTGAGCCTGGTAGG - Intergenic
1119012314 14:71006010-71006032 GAGGATCACTTAAGCCTAGGAGG - Intronic
1119597138 14:75945344-75945366 GAGAATCACTTGAGCCTAGTGGG - Intronic
1119746214 14:77046075-77046097 GAGTATCACTTAAGCCCAGGAGG - Intergenic
1120833695 14:89021494-89021516 GAGGATCACTTAAGCCCAGTAGG - Intergenic
1122506864 14:102237137-102237159 GGTTATCTCTGAAGCCTTGAGGG - Intronic
1122513671 14:102290726-102290748 GAGGATCCCTGAACCCTAATGGG + Intronic
1122731064 14:103798790-103798812 GAGGATCTCTGGAGTCTAGGAGG - Intronic
1122755326 14:103974110-103974132 GAGGATCACTGAAGCCCAGGAGG + Intronic
1122980514 14:105190323-105190345 GAGGATCTCTTGAGCCTAGGAGG + Intergenic
1125431021 15:39593555-39593577 GAGTATCCCTGAGCCCTCGTGGG - Exonic
1125543417 15:40486074-40486096 GAGTATCGCTTAAGCCCAGGAGG - Intergenic
1125857542 15:42964698-42964720 GAGTATGGCTGAAGCCTAAGGGG - Intronic
1127027183 15:54819859-54819881 GAGAATCACTGAAGCCCAGGAGG - Intergenic
1127482051 15:59386728-59386750 GAGGATCACTTAAGCCTAGGAGG + Intronic
1127538669 15:59915619-59915641 GAGAATCTATTGAGCCTAGTAGG - Intergenic
1128103197 15:65022794-65022816 GAGGATCTCTTCAGCCTAGGAGG - Intronic
1128169303 15:65496738-65496760 GAGGATCACTCAAGCCTAGGAGG - Intronic
1129546873 15:76405201-76405223 GAGGATCTCTTGAGCCCAGTAGG - Intronic
1129790096 15:78335418-78335440 GAGAATCACTTAAGCCTAGTGGG - Intergenic
1130144026 15:81258608-81258630 GAGGATCTCTGGAGCCCAGGAGG + Intronic
1130753186 15:86735169-86735191 GAGAATCTCTGAAACCCAGGAGG - Intronic
1132527295 16:423785-423807 GAGGATCTCTTGAGCCTAGGAGG + Intergenic
1133552879 16:6875248-6875270 CAGTATCTCTGAAGACTCTTCGG + Intronic
1133920393 16:10147544-10147566 GAGGATCTCTTGAGCCTGGTAGG + Intronic
1134099943 16:11444997-11445019 GAGGATCACTTAAGCCTAGGAGG + Intronic
1135016731 16:18929825-18929847 GAGAATCACTTAAGCCTAGGAGG + Intergenic
1135089420 16:19501170-19501192 GAGGATCACTGGAGCCTAGCAGG - Intergenic
1135322365 16:21505678-21505700 GAGAATCACTTAAGCCTAGGAGG + Intergenic
1135535844 16:23293832-23293854 GAGGATCTCTTGAGCCTAGGAGG + Intronic
1135619906 16:23946943-23946965 GAGAATCGCTTAAGCCTAGAAGG - Intronic
1135659767 16:24285931-24285953 GAGGATTGCTTAAGCCTAGTGGG - Intronic
1135726200 16:24855509-24855531 GAGGATCTCTTGAGCCTAGGAGG + Intronic
1136030235 16:27497400-27497422 GAGTCTCTCCAAAGCCTTGTAGG + Intronic
1136163206 16:28435047-28435069 GAGGATCACTCAAGCCTAGGAGG + Intergenic
1136199759 16:28679940-28679962 GAGGATCACTCAAGCCTAGGAGG - Intergenic
1136216107 16:28794113-28794135 GAGGATCACTCAAGCCTAGGAGG - Intergenic
1136333843 16:29598808-29598830 GAGAATCACTTAAGCCTAGGAGG + Intergenic
1137448262 16:48545935-48545957 GAGGATCGCTGAAGCCCAGTGGG + Intronic
1137896754 16:52220928-52220950 GAGTATCACTTAAGCCTAGGAGG - Intergenic
1138047010 16:53735692-53735714 CATTGTCTTTGAAGCCTAGTTGG + Intronic
1138049979 16:53766313-53766335 GAGGATCGCTGAAGCCTGGGAGG - Intronic
1138381277 16:56604407-56604429 GAGGATCTCTTAAGCCCAGGAGG + Intergenic
1138502272 16:57454566-57454588 GAGGATCTCTTGAGCCTGGTAGG + Intronic
1138641994 16:58395163-58395185 GAGGATCTCTGGAGCCTGGGAGG - Exonic
1139013720 16:62664561-62664583 GAGTATATCTTAAGCCTAGGAGG - Intergenic
1139555791 16:67709216-67709238 GAGGATCTCTTGAGCCCAGTAGG + Intronic
1142447685 16:90152213-90152235 GAGCATCTCTTGAGCCCAGTTGG + Intergenic
1142459805 17:83110-83132 GAGCATCTCTTGAGCCCAGTTGG - Intergenic
1142887751 17:2923419-2923441 GAGAATCTCTGGAGCCTGGGAGG - Intronic
1143076360 17:4347562-4347584 GAGAATCTCTCAAACCTAGGAGG - Intronic
1144680832 17:17193146-17193168 GAGAATCTCTTGAGCCTAGGAGG - Intronic
1144970314 17:19104885-19104907 GAGGATCCCTTAAGCCTAGCAGG - Intergenic
1144990619 17:19231048-19231070 GAGGATCCCTTAAGCCTAGCAGG - Intronic
1145212660 17:21026413-21026435 GAGGATCTCTTGAGCCTAGGAGG - Intronic
1145948517 17:28797090-28797112 GAGAATCACTGAAGCCCAGGAGG - Intronic
1146149033 17:30450767-30450789 GAGGATCACTTGAGCCTAGTAGG + Intronic
1146318676 17:31829528-31829550 GAGGATCTCTTGAGCCTAGGAGG - Intergenic
1146860514 17:36293970-36293992 GAGCATTGCTGAAGCCTAGGAGG - Intronic
1146961377 17:36983129-36983151 GAGGATCCCTTAAGCCTAGGTGG - Intronic
1147090843 17:38098068-38098090 GAGCATTGCTGAAGCCTAGGAGG - Intergenic
1147106368 17:38222439-38222461 GAGCATTGCTGAAGCCTAGGAGG + Intergenic
1147435415 17:40409996-40410018 GAGAATCACTGAAACCTAGGAGG + Intronic
1147710707 17:42462123-42462145 GAGGATCGCTGAAGCCCAGGAGG + Intronic
1147782401 17:42953067-42953089 GAGAATCTCTTGAGCCTGGTAGG - Intronic
1148423146 17:47566081-47566103 GAGCATTGCTGAAGCCTAGGAGG - Intronic
1148477064 17:47935641-47935663 GAGGATCTCTTAAGCCCAGGAGG + Intergenic
1148625369 17:49065323-49065345 GAGAATCACTGAAGCCTGGGGGG - Intergenic
1149269354 17:54959705-54959727 GAGGATCACTGGAGCCTAGGAGG - Intronic
1149642440 17:58212394-58212416 GAGTATCTCAGCAGCCTCGTAGG - Exonic
1149873061 17:60200947-60200969 GAGAATCTCTCAAGCCCAGAAGG - Intronic
1150021130 17:61614737-61614759 GAGGATCTCTGGAGCCCAGGAGG - Intergenic
1150086840 17:62278220-62278242 GAGAATCTCTCAAGCCCAGAAGG - Intronic
1150131036 17:62669302-62669324 GAGAATCTCTTGAGCCTAGGAGG - Intronic
1150134022 17:62685627-62685649 GAGGATCACTTAAGCCTAGGAGG - Intronic
1150685344 17:67316213-67316235 GAGGATCACTGAAGCCTGGGAGG - Intergenic
1151275241 17:73029294-73029316 GACTATCTTGGAAGCCCAGTTGG + Intronic
1151493908 17:74448209-74448231 GAGGATCTCTTAAGCCCAGGAGG + Intronic
1153448594 18:5200275-5200297 GAGGATCTCTTGAGCCTAGGAGG - Intergenic
1153484833 18:5586487-5586509 GAGGATCACTTAAGCCTAGAAGG - Intronic
1153690525 18:7588937-7588959 GAGGATCACTGGAGCCCAGTAGG - Intronic
1153755177 18:8275352-8275374 GAGGATCACTGGAGCCCAGTAGG + Intronic
1155266887 18:24103010-24103032 GAGGATCCCTGGAGCCTAGGAGG + Intronic
1155319351 18:24603859-24603881 GAGAATCTCTTGAACCTAGTAGG - Intergenic
1155357891 18:24971166-24971188 GTGTATCTCTTTAGACTAGTAGG - Intergenic
1155973293 18:32101964-32101986 GAGGATCGCTTAAGCCTAGGAGG - Intronic
1156304620 18:35865832-35865854 GAGGATCTCTTGAGCCTAGGAGG - Intergenic
1156427650 18:37032088-37032110 GAGAATCTCTGGAGCCCAGGAGG + Intronic
1157108109 18:44793652-44793674 GATTATGTTTGAAACCTAGTAGG - Intronic
1157531558 18:48425367-48425389 GAGTACCTCTGATGGCGAGTGGG - Intergenic
1158249778 18:55474862-55474884 GAGGATCTCCTAAGCCTAGGAGG - Intronic
1158472042 18:57745744-57745766 GAGGATCACTGAAGCCCAGGAGG - Intronic
1159403411 18:67967403-67967425 TTGTATCTCTGAAGCCTGATGGG + Intergenic
1159687808 18:71445064-71445086 GAGTATCTCTCAACCCTGGGAGG - Intergenic
1160649521 19:215618-215640 GAGCATCTCTTGAGCCCAGTTGG - Intergenic
1161082125 19:2316525-2316547 GAGGATCTCTTGAGCCTAGGAGG - Intronic
1161902171 19:7126986-7127008 GAGGATCTCTGGAGCCCAGAAGG - Intronic
1162330519 19:10026295-10026317 GAGGATCTCTTGAGCCTAGCAGG - Intergenic
1162333916 19:10048289-10048311 GAGGATCTCTTGAGCCCAGTAGG + Intergenic
1163031544 19:14547746-14547768 GAGTATCACTTAAGCCCAGGAGG - Intronic
1163128708 19:15258697-15258719 GAGGATCTCTTGAGCCTAGGAGG - Intronic
1163485715 19:17584287-17584309 GAGTATCTCTTGAGTCTAGGAGG + Intergenic
1163570367 19:18078017-18078039 GAGGATCTCTTGAGCCTAGGAGG + Intronic
1163877576 19:19886392-19886414 ATGTGTCTGTGAAGCCTAGTTGG + Intronic
1163881655 19:19928917-19928939 GTGTGTCTGTGAAGCCTAGTTGG + Intronic
1163883554 19:19947316-19947338 GACTATCTCTAAAGCCTTGAGGG - Intergenic
1163910834 19:20190788-20190810 TTGTGTCTGTGAAGCCTAGTTGG + Intronic
1163926298 19:20347245-20347267 GTGTGTCTGTGAAGCCTAGATGG - Intergenic
1163932046 19:20404409-20404431 GTGTGTCTGTGAAGCCTAGTTGG - Intergenic
1163944932 19:20527208-20527230 GTGTGTCTGTGAAGCCTAGTTGG + Intergenic
1163955888 19:20639330-20639352 ATGCATCTGTGAAGCCTAGTTGG - Intronic
1163960068 19:20681482-20681504 ATGTGTCTGTGAAGCCTAGTTGG + Intronic
1163971497 19:20800407-20800429 ATGTATCTATGAAGCCTATTTGG + Intronic
1164209738 19:23088551-23088573 GAGAATCTCTTGAGCCCAGTAGG - Intronic
1164241102 19:23389893-23389915 CAGTATCTCAGAAGCATAGATGG - Intronic
1165017960 19:32897649-32897671 GAGGATCACTTAAGCCTAGGAGG - Intronic
1165032660 19:33009538-33009560 GAGGATCTCTTAAGCCCAGGAGG - Intronic
1165362115 19:35343186-35343208 GAGTATCACTTGAGCCTAGGGGG - Intronic
1165677030 19:37735142-37735164 GAGGATCACTGAAGCCCAGGAGG + Intergenic
1166371811 19:42306109-42306131 GAGGATCACTTAAGCCTAGGAGG - Intronic
1166379239 19:42346585-42346607 GAGTATCTCTTGAGCCTGGGAGG + Intronic
1166877201 19:45904521-45904543 GAGAATCTCTTGAGCCTAGGAGG + Intergenic
1167041540 19:47025663-47025685 GAGGAACTCTTGAGCCTAGTAGG - Intronic
1167453563 19:49586310-49586332 GAGGATCACTGGAGCCTAGGAGG - Intronic
1167526988 19:49990468-49990490 GAGGATCACTGGAGCCTAGGAGG - Intronic
1167656839 19:50770457-50770479 GAGGATCTCTTGAGCCTAGGAGG + Exonic
1167940196 19:52940508-52940530 GAGGATCGCTTAAGCCTAGGAGG + Intronic
1168223189 19:54975838-54975860 GAGGATCTCTGGAGCCTGGAAGG - Intronic
926192765 2:10741176-10741198 CAGTTTCTGTGAAGCCAAGTTGG + Intronic
926575558 2:14576489-14576511 GAGGATCCCTGGAGCCTAGGAGG - Intergenic
926672569 2:15589846-15589868 GAGGATCTCTTGAGCCTAGGAGG - Intergenic
926925368 2:17981827-17981849 GAGAATCTCTTAAGCCTGGAAGG + Intronic
928006097 2:27563483-27563505 GAGGATCTCTGGAGCCTGGGAGG - Intronic
928175810 2:29033668-29033690 GGGTATCGCTGAGACCTAGTTGG + Intronic
928520012 2:32079419-32079441 GAGAATCGCTTAAGCCTAGGAGG + Intronic
928527125 2:32152465-32152487 GAGGATCTCTTAAGCCTGGGAGG + Intronic
930069270 2:47352851-47352873 GAGGATCTCTTGAGCCTAGGAGG - Intronic
932038951 2:68277973-68277995 GAGGATCACTCAAGCCTAGGAGG - Intergenic
932243634 2:70177948-70177970 GAGGATCTCTTGAGCCTAGGAGG + Intronic
933258327 2:80105638-80105660 GAGGATCTCTTGAGCCTAGGAGG + Intronic
934962747 2:98691348-98691370 GAGGATCACTGGAGCCTAGGAGG + Intronic
935664343 2:105497136-105497158 GGGTGGATCTGAAGCCTAGTAGG - Intergenic
936974993 2:118209658-118209680 GAGTATCCCTGAGGGCAAGTTGG + Intergenic
937148695 2:119670685-119670707 GAGGATCCCTGGAGCCTAGGAGG + Intergenic
938494721 2:131788727-131788749 GAGGATCTCTTGAGCCTAGGTGG - Intergenic
939091721 2:137787455-137787477 CAGTCTCTCTGAAGCCTTGGAGG - Intergenic
941257744 2:163254532-163254554 GAGGATCACTGAAACCTAGGAGG + Intergenic
941639972 2:167976796-167976818 CAGTCTCTCTGAAGGCTTGTAGG - Intronic
941985420 2:171505983-171506005 GAGTATCACTTAAGCCTAGGAGG - Intergenic
942892042 2:181002048-181002070 CAGTATCATAGAAGCCTAGTTGG + Intronic
948989320 2:241544289-241544311 GAGGATCACTTAAGCCTAGGAGG - Intergenic
1170840185 20:19918990-19919012 GAGTTTCTCTGAAGGCTGGGAGG + Intronic
1172084642 20:32371373-32371395 GAGGATCACTTGAGCCTAGTAGG - Intronic
1172242817 20:33424601-33424623 GAGGATCGCTTAAGCCTAGGAGG - Intronic
1172269157 20:33643492-33643514 GAGGATCCCTGGAGCCTAGGAGG + Intronic
1173693195 20:44982204-44982226 GAGGATCACTGAAGCCCAGGAGG - Intronic
1174317826 20:49716203-49716225 GAGGATCTCTTAAGCCCAGGAGG + Intergenic
1175881206 20:62260278-62260300 GAGTCTCTCTGAACCCTTGCTGG - Intronic
1177180895 21:17744243-17744265 GAGGATCACTGAAGCCCAGGAGG - Intergenic
1178401164 21:32285948-32285970 GAGAATCACTTAAGCCTAGGAGG + Intergenic
1178540364 21:33444453-33444475 GAGGATCTCTTGAGCCTAGGAGG + Intronic
1178718195 21:34985959-34985981 GAGTATCTCTTGAGCCTAGGAGG - Intronic
1178951924 21:36992310-36992332 GAGGATCTCTTGAGCCTAGGAGG + Intergenic
1179475835 21:41643253-41643275 GAGTATCGCTTGAGCCTAGGAGG + Intergenic
1180218476 21:46342194-46342216 GAGAATCACTTAAGCCTAGGAGG - Intronic
1180930004 22:19583268-19583290 GAGGATCACTGAAGCCTGGGAGG + Intergenic
1181014229 22:20060043-20060065 GAGGATCTCTTAAGCCCAGGAGG - Intronic
1181510752 22:23387729-23387751 GAGGATCCCTCAAGCCCAGTTGG + Intergenic
1181642668 22:24211875-24211897 GAGGATCTCTTGAGCCTAGGAGG + Intergenic
1181805831 22:25373991-25374013 GAGGATCTCTTGAGCCTAGGAGG - Intronic
1181936307 22:26441386-26441408 GAGCATCTCTAGAGCCTAGGAGG + Intronic
1183657451 22:39195947-39195969 GAGGATCTCTTGAGCCTAGGAGG + Intergenic
1183892744 22:40943823-40943845 GAGGATCTCTTGAGCCTAGGAGG - Intergenic
1184225600 22:43127504-43127526 GGGTATCTCTGAATCCAAGTGGG + Intronic
949163452 3:909607-909629 GAGTATCACTTAAGCCCAGGAGG + Intergenic
949351809 3:3130990-3131012 GAGGATCACTGAAGCCTGGGAGG + Intronic
950403510 3:12789147-12789169 GAGGATCTCTTAAGCCCAGGAGG + Intergenic
951215629 3:20022093-20022115 GAGGATCACTGAAGCCTGGGAGG + Intergenic
952370005 3:32712747-32712769 AAGGATCTCTTGAGCCTAGTAGG + Intronic
952370721 3:32720580-32720602 GAGGATCGCTGGAGCCTAGGAGG - Intronic
952381397 3:32808178-32808200 GAGAATCTCTTAAGCCTGGGAGG + Intergenic
952581075 3:34834202-34834224 GAGAATCTCTTAAGCCTGGGAGG + Intergenic
952934121 3:38382254-38382276 GAGGATCGCTTAAGCCTAGGAGG + Intronic
953952404 3:47201350-47201372 AAGGATCTCTGGAGCCTAGGAGG - Intergenic
954063981 3:48091191-48091213 GAGGATCGCTTAAGCCCAGTGGG + Intergenic
959271373 3:104214896-104214918 GGGTTTCTCTAAAGCCTGGTAGG + Intergenic
959671347 3:108980934-108980956 GAGTTTCTTTGAAGCAGAGTGGG + Intronic
959736238 3:109661943-109661965 GAGTATTTCTGAAATCTAGTGGG - Intergenic
960489711 3:118300516-118300538 GAGTATCTCCTAAGCCCAGGAGG + Intergenic
961187151 3:124925701-124925723 GAGTATCACTCAAGCCTGGGAGG - Intronic
961472615 3:127125585-127125607 GAGGATCTCTTAAGCCTGGGAGG + Intergenic
963740234 3:149071961-149071983 GAGGATCACTTCAGCCTAGTAGG + Intronic
964390398 3:156190781-156190803 GAGAATCTCTTAAACCTAGGAGG - Intronic
964470440 3:157047773-157047795 GAGTATCCCTGGAGCCCAGGAGG + Intergenic
965149056 3:164946787-164946809 GAGAATCTCCGAAGCCAAGTAGG + Intergenic
965208003 3:165746667-165746689 GAGAATCTCTGACTCCTAATTGG - Intergenic
965692033 3:171367557-171367579 GAGAATCTCTTAAGCCTGGGAGG - Intronic
965734563 3:171807216-171807238 GAGTATCACTTGAGCCTAGGAGG + Intronic
965822681 3:172700595-172700617 GAGGATCTCTTGAGCCTAGGAGG - Intronic
966303390 3:178503611-178503633 GAGGATCTCTTGAGCCTAGGAGG - Intronic
966580182 3:181552585-181552607 GAGGATCTCTTGAGCCTAGAAGG + Intergenic
967625636 3:191680591-191680613 GAGTATCTCTAAAGCTGACTAGG + Intergenic
968368326 3:198204513-198204535 GAGCATCTCTTGAGCCCAGTTGG + Intergenic
968837553 4:2976319-2976341 GAGGATCACTGGAGCCTAGGAGG - Intronic
970171630 4:13296469-13296491 GAGGATCTCTTAAGCCCAGGAGG - Intergenic
971713015 4:30141418-30141440 GAGCATCTCTTGAGCCTAGGAGG - Intergenic
972322678 4:37986865-37986887 GGGTGTCTCTGCAGCCTGGTAGG + Intronic
972580046 4:40387146-40387168 GAGGATCTCTTAAGCCTTGGAGG - Intergenic
972924707 4:43989480-43989502 GAGAATACCTGGAGCCTAGTAGG + Intergenic
974435062 4:61846088-61846110 GAGGATCTCTTAAGCCCAGGAGG + Intronic
975576666 4:75869755-75869777 GAGGATCTCTTAAGACTAGCAGG + Intronic
976153763 4:82120186-82120208 GAGGATCTCTTGAGCCTAGGAGG + Intergenic
976632037 4:87248454-87248476 GAGAATCTCTTAAACCTAATAGG + Intergenic
976700253 4:87962127-87962149 GAGAATCTCTTGAGCCTAGGAGG + Intergenic
976906900 4:90248785-90248807 GAGGATCGCTTAAGCCTAGAAGG - Intronic
977299362 4:95250293-95250315 GAGTATCCCTTGAGCCTAGGAGG + Intronic
978580513 4:110227097-110227119 GAGGATCTCTTGAGCCTAGGAGG + Intergenic
979211234 4:118106433-118106455 GAGGATTTCTTAAGCCTAGGAGG - Intronic
983272175 4:165575266-165575288 GAGAATCTCTTGAGCCTAGGAGG - Intergenic
985690149 5:1304416-1304438 GAGAATCACTTAAGCCTAGGAGG - Intergenic
985925340 5:3011686-3011708 GTCTGTCTCTGAAGCCCAGTTGG + Intergenic
988809661 5:34771996-34772018 GAGGATCACTTAAGCCTAGGAGG - Intronic
989042328 5:37241714-37241736 GAGGATCACTGAAGCCCAGGAGG - Intronic
990004932 5:50934934-50934956 GAGGATCTCTGGAGCCAAGGAGG + Intergenic
990289875 5:54339234-54339256 GAGAATCACTGGAGCCCAGTGGG - Intergenic
990430827 5:55733770-55733792 AAGTTTCTCTGAATCCTAGTTGG + Intronic
990932696 5:61111524-61111546 GAGGATCGCTTAAGCCTAGGAGG - Intronic
992314606 5:75539583-75539605 GAGTATCTCTGAAGCCTAGTAGG - Intronic
995892169 5:116967046-116967068 AAGTATCAGTGGAGCCTAGTGGG - Intergenic
996746718 5:126852556-126852578 GAGAATCTCTTGAGCCTAGGAGG - Intergenic
996938651 5:128976948-128976970 AAGTAAATCTGAAGCCTTGTGGG + Intronic
997448257 5:133959302-133959324 GAGAATCACTTAAGCCTAGGAGG + Intronic
997520022 5:134517155-134517177 GAGGATCTCTTGAGCCTAGGAGG + Intergenic
997937367 5:138125010-138125032 GAGGATCACTGGAGCCTAGGAGG - Intronic
999109224 5:149103289-149103311 GAGTATCGCTTGAGCCTAGGAGG + Intergenic
999132606 5:149295908-149295930 GGGTAACTTTGAAGGCTAGTGGG + Intronic
1000108113 5:158080028-158080050 GAGGATCACTTGAGCCTAGTAGG + Intergenic
1001483917 5:172106310-172106332 GAGGATCTCTTGAGCCTAGGAGG + Intronic
1002534366 5:179868125-179868147 GAGAATCACTGTAGCCCAGTAGG - Intronic
1002727547 5:181309740-181309762 GAGCATCTCTTGAGCCCAGTTGG + Intergenic
1003883923 6:10503726-10503748 GAGTATCTCTTGAGCCCAGGAGG + Intronic
1004250815 6:14021844-14021866 GAGGATCACTGAAGCCCAGGAGG - Intergenic
1004347663 6:14863576-14863598 GAGAATCTCTTAAGCCTGGGAGG - Intergenic
1004516209 6:16324359-16324381 GAGGATCGCTGGAGCCTAGGAGG + Intronic
1004986583 6:21089385-21089407 GAGGATCACTGGAGCCTAGGAGG + Intronic
1006817269 6:36860370-36860392 GAGGATCACTCAAGCCCAGTAGG + Intronic
1006948953 6:37805639-37805661 GAGGATCCCTTGAGCCTAGTAGG - Intergenic
1007533865 6:42566819-42566841 GAGGATCTCTTGAGCCTAGGAGG - Intronic
1007695486 6:43730125-43730147 GAGAATCTCTTGAGCCTAGGAGG + Intergenic
1007899297 6:45395071-45395093 AAGTGTGGCTGAAGCCTAGTAGG - Intronic
1008653993 6:53592591-53592613 GAGGATCTCTTGAGCCCAGTAGG - Intronic
1009293104 6:61909154-61909176 GAGAATCTCTTGAGCCTAGGAGG - Intronic
1010203367 6:73301719-73301741 GAGTATCACTTGAGCCTAGGAGG - Intronic
1010987040 6:82436803-82436825 GAGAATCTCTTAAACCTAGGAGG + Intergenic
1011419997 6:87161510-87161532 GAGGATCGCTTAAGCCCAGTTGG - Intronic
1012532642 6:100256519-100256541 CAGAATTTATGAAGCCTAGTAGG + Intergenic
1013743199 6:113313747-113313769 GAGGATCACTCAAGCCCAGTAGG - Intergenic
1014215741 6:118751071-118751093 GAGGATCTCTTGAGCCTAGGAGG + Intergenic
1014523098 6:122469464-122469486 GAGAATCTCTTAAGCCCAGGAGG - Intronic
1015769746 6:136756226-136756248 GAGGATCACTTAAGCCTGGTAGG + Intronic
1015774984 6:136804812-136804834 GAGGATCACTGAAGCCTGGGAGG + Intergenic
1018396667 6:163383119-163383141 GAGGATCTCTTGAGCCTAGGAGG + Intergenic
1018535088 6:164810950-164810972 GAATGTCTCTGAAGTTTAGTTGG + Intergenic
1019690903 7:2411170-2411192 GAGGATCTCTTAAGCCCAGGAGG - Intronic
1020175852 7:5881538-5881560 GAGGATCACTGAAGCCCAGGAGG + Intronic
1020758081 7:12230126-12230148 GAGGATCACTGGAGCCCAGTAGG + Intronic
1021169769 7:17384490-17384512 GACTATTTCTGAAGCCAATTGGG - Intergenic
1021245770 7:18259450-18259472 GAGGATCTCTGGAGCCTGGGAGG - Intronic
1021385873 7:20029265-20029287 GAGGATCTCTTGATCCTAGTAGG - Intergenic
1021595405 7:22311113-22311135 GAGGATCTCTCAAGTCTAGGAGG - Intronic
1022009138 7:26293288-26293310 GAGGATCACTGAAGCCTGGGAGG - Intronic
1023261824 7:38366124-38366146 GAGAATCTCTTGAGCCTAGAAGG - Intergenic
1023330961 7:39116293-39116315 GAGGATCTCTTGAGCCTAGGAGG + Intronic
1023398734 7:39775527-39775549 GAGCATCTCTTGAGCCCAGTTGG + Intergenic
1024651705 7:51409167-51409189 GAGCATCTCTTGAGCCCAGTTGG - Intergenic
1024858820 7:53814099-53814121 GAGGATCGCTTAAGCCCAGTAGG - Intergenic
1025133913 7:56394963-56394985 GAGCATCTCTTGAGCCCAGTTGG - Intergenic
1025185513 7:56855185-56855207 GAGCATCTCTGGAGCCCAGTTGG - Intergenic
1025686419 7:63721768-63721790 GAGCATCTCTGGAGCCCAGTTGG + Intergenic
1026821463 7:73552421-73552443 GAGGATCACTCAAGCCTAGGAGG + Intronic
1027126537 7:75560336-75560358 GAGGATCTCTTGAGCCTAGGAGG - Intronic
1027771230 7:82408885-82408907 TAGTATCTTTGAAGCTTTGTTGG - Intronic
1029035879 7:97521150-97521172 GAGAATCTCTGGAACCTGGTAGG - Intergenic
1029085989 7:98012184-98012206 GAGGATCGCTGAAGCCCAGGAGG - Intergenic
1029119463 7:98257262-98257284 GAGGATCGCTTAAGCCTAGGAGG + Intronic
1029461466 7:100696314-100696336 GAGGATCACTTAAGCCTAGGAGG - Intergenic
1029542765 7:101194081-101194103 GAGACTCTCTTAAGCCTAGGAGG - Intergenic
1029658347 7:101942550-101942572 GAGGATCGCTGAAGCCCAGGAGG - Intronic
1029697301 7:102222186-102222208 GAGGGTCTCTGAAGCCCAGGAGG + Intronic
1030560473 7:111078818-111078840 GAGAATCACTGAAACCTGGTAGG - Intronic
1030857643 7:114581271-114581293 GAGGATCGCTTAAGCCTAGGAGG - Intronic
1031010063 7:116516848-116516870 GACTAACTCTCAAACCTAGTAGG - Intergenic
1032583197 7:133122575-133122597 GAGGATCTCTTCAGCCTAGAAGG + Intergenic
1033404546 7:141059859-141059881 GAGGATCTCTTAAGCCTGGGAGG + Intergenic
1035877994 8:3212436-3212458 GAGGATCGCTGGAGCCTGGTAGG - Intronic
1038014885 8:23506220-23506242 GAGGATCTCTTAAGCCTGGGAGG - Intergenic
1038078806 8:24108874-24108896 GAGAATCTCTTGAGCCTAGGAGG - Intergenic
1038715802 8:29989980-29990002 GAGGATCTCTGGAGCCCAGGAGG - Intergenic
1039220404 8:35324141-35324163 GAGTATCACTGGAGCCCAGGAGG + Intronic
1039484518 8:37900187-37900209 GAGGATCTCTGGAGCCCAGGAGG + Intergenic
1039597568 8:38804690-38804712 GAGGATCGCTTAAGCCTAGGAGG - Intronic
1039954073 8:42194140-42194162 GAGGATCTCTTGAGCCTGGTGGG - Intronic
1039957247 8:42217141-42217163 GAGGATCTCTGCAGCCCAGGAGG + Intergenic
1041979631 8:63842206-63842228 GAGGATCCCTGGAGCCTAGGAGG - Intergenic
1042700610 8:71608678-71608700 GAGTCTCTCCTGAGCCTAGTTGG - Intergenic
1043439551 8:80265255-80265277 GAGGATCTCTTGAGCCTAGGAGG + Intergenic
1044241052 8:89888971-89888993 GAGGATCACTTAAGCCTAGGAGG + Intergenic
1044647887 8:94463823-94463845 GAGGATCACTTGAGCCTAGTAGG + Intronic
1048496497 8:134940245-134940267 GAGCAGCTCTGATACCTAGTGGG + Intergenic
1049069892 8:140348250-140348272 GACTATCACTGAAACTTAGTTGG - Intronic
1051272541 9:15369242-15369264 GAGGATCTCTCAAGCCTGGGAGG + Intergenic
1051327069 9:15983520-15983542 GAGAATCTCTGAAGCATATGTGG + Intronic
1054747173 9:68866204-68866226 GAGAATCTCTGGAGCCTGGGAGG + Intronic
1055205033 9:73718838-73718860 GAGTATCTCTTGAGCCCAGGAGG + Intergenic
1055786664 9:79876988-79877010 GAGGATCTCTTAAGACTAGGAGG + Intergenic
1056336991 9:85581564-85581586 GAGTATCCCTGATTCTTAGTAGG - Intronic
1056689553 9:88795285-88795307 GAGGATCACTGGAGCCTAGGAGG - Intergenic
1057611491 9:96547541-96547563 GAGGATCCCTCAAGCCTAGGAGG - Intronic
1058402197 9:104632401-104632423 GAGGATCACTTAAGCCTAGGAGG - Intergenic
1058868264 9:109181099-109181121 GAGGATCTCTGGAGCCCAGGAGG - Intronic
1059209655 9:112501032-112501054 GAGGATCTCTTGAGCCTAGGAGG + Intronic
1061229727 9:129308116-129308138 GAGGATCTCTTGAGCCTAGGAGG + Intergenic
1061381150 9:130258592-130258614 GAGGATCGCTTAAGCCTAGGAGG + Intergenic
1061494494 9:130963968-130963990 GAGAATCGCTCAAGCCTAGGAGG + Intergenic
1061821956 9:133233871-133233893 CCGTGTCTCTGTAGCCTAGTTGG - Intergenic
1062237343 9:135516643-135516665 CCGTGTCTCTGTAGCCTAGTCGG + Intergenic
1062752666 9:138267218-138267240 GAGCATCTCTTGAGCCCAGTTGG + Intergenic
1203575184 Un_KI270745v1:1993-2015 GAGCATCTCTTGAGCCCAGTTGG + Intergenic
1186060919 X:5706181-5706203 GAGGATCTCTTGAGCCTAGGAGG - Intergenic
1186089347 X:6027904-6027926 GAGAATCTCTGGAACCCAGTAGG - Intronic
1186630984 X:11348737-11348759 GAGAATCGCTTAAGCCTAGGAGG - Intronic
1186712930 X:12219277-12219299 GAGGATCGCTTAAGCCTAGGAGG + Intronic
1187902498 X:24037783-24037805 GAGGATCACTTAAGCCTAGGAGG + Intergenic
1188695251 X:33182352-33182374 GAGGATCACTGGAGCCTAGGAGG - Intronic
1189025052 X:37385848-37385870 GAGTATCGCTTGAGCCTGGTAGG - Intronic
1189851124 X:45177215-45177237 GAGTATCTCTTGAGTCTAGGAGG + Intronic
1190014070 X:46811593-46811615 GAGAATCTCTTAAGCCCAGGAGG - Intergenic
1190583237 X:51909146-51909168 GAGTATCACTGGAGCCCAGGAGG - Intergenic
1190635578 X:52430350-52430372 GAGAATCTCTTGAGCCCAGTAGG - Intergenic
1190680014 X:52818559-52818581 GAGTATCCCTTGAGCCTAGGAGG + Intergenic
1192507204 X:71695014-71695036 GAGGATCGCTTAAGCCTAGGAGG + Intergenic
1192519493 X:71786535-71786557 GAGGATCGCTTAAGCCTAGGAGG - Intergenic
1193382494 X:80831756-80831778 GAGGATCACTTAAGCCTAGGAGG - Intergenic
1194299485 X:92168035-92168057 GAGGATCACTTGAGCCTAGTAGG - Intronic
1198211159 X:134517365-134517387 GAGGATCACTTAAGCCTAGGAGG + Intronic
1199825013 X:151490076-151490098 GAGGATCCCTTAAGCCTAGAAGG + Intergenic
1200098847 X:153678362-153678384 GAGGATCTCTTGAGCCTAGGAGG + Intronic
1200161310 X:154011312-154011334 GAGGATCGCTGGAGCCCAGTAGG - Exonic
1200617132 Y:5393164-5393186 GAGGATCACTTGAGCCTAGTAGG - Intronic
1200953368 Y:8922074-8922096 GAGTATCTCTTAAACCCAGGAGG - Intergenic