ID: 992315021

View in Genome Browser
Species Human (GRCh38)
Location 5:75543697-75543719
Sequence TTAGGTATCAATAAGCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 111}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992315017_992315021 8 Left 992315017 5:75543666-75543688 CCTATGAAACTGGACAAAAGTTT 0: 1
1: 0
2: 2
3: 26
4: 291
Right 992315021 5:75543697-75543719 TTAGGTATCAATAAGCAGGAAGG 0: 1
1: 0
2: 1
3: 7
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992315021 Original CRISPR TTAGGTATCAATAAGCAGGA AGG Intronic
904740941 1:32675466-32675488 TTACTTATCAAAAAGAAGGATGG + Intronic
905224990 1:36473062-36473084 TCAGATAGCAATAAGCAGAAAGG - Intronic
905274588 1:36808960-36808982 TTAGGTTCCAATAACCAGGATGG - Intronic
908979493 1:69937335-69937357 TTAGTAATCTAGAAGCAGGAAGG - Intronic
910568906 1:88678458-88678480 TTTGGGAACAATAAGCAGAACGG + Intergenic
911936343 1:103979101-103979123 AAAGGTAACAATAAGTAGGAAGG - Intergenic
912577411 1:110686117-110686139 TCAGGTAGCCATAAGCAGGCAGG - Intergenic
912873686 1:113332972-113332994 TTAGGGAACAATAGGGAGGAGGG - Intergenic
915953044 1:160202846-160202868 TCTGGTAGCGATAAGCAGGATGG + Intergenic
916705442 1:167344721-167344743 TTAGCTATCTATTAGGAGGAAGG + Intronic
917510589 1:175666305-175666327 TTAGGATACAAGAAGCAGGAAGG - Intronic
919278595 1:195455003-195455025 TTATGTATGTATATGCAGGAAGG - Intergenic
921950036 1:220920014-220920036 TTAGGTATTAATAAGAAAGAGGG + Intergenic
924617662 1:245626937-245626959 CTAGATATCCATAAGCAGAAGGG - Intronic
1063062397 10:2569666-2569688 TTAGGAATCAGGAATCAGGATGG - Intergenic
1065783020 10:29188151-29188173 TTGGGTATTAACAACCAGGAAGG + Intergenic
1066173979 10:32884686-32884708 ATAGGTATAGATAAGCAAGATGG + Intergenic
1068503706 10:57871922-57871944 TTATGAATCAATAAGGAAGAAGG - Intergenic
1069239051 10:66115793-66115815 TTAAGTAAGGATAAGCAGGACGG + Intronic
1072511338 10:96129385-96129407 TGAGGTATCAATTAGTAGGTTGG + Intergenic
1073430922 10:103486445-103486467 TTAGGTGTCCTCAAGCAGGAGGG + Intergenic
1080955471 11:37089189-37089211 TTAAGGTTGAATAAGCAGGATGG + Intergenic
1085911029 11:80826964-80826986 TTAGGTACCAAAAAGCAGATGGG + Intergenic
1090069583 11:123532031-123532053 TTAAGAATTAATAAACAGGACGG - Intronic
1094763595 12:33563974-33563996 CTAGGAATCAATAAACAAGAGGG + Intergenic
1100866584 12:98864156-98864178 TTATGTATCAATAAACAAAATGG - Intronic
1100991692 12:100258234-100258256 TTAGGTATCAATAAGAAAACTGG + Intronic
1101311323 12:103582361-103582383 TTAGGTATCAAATATCAGAATGG + Intergenic
1101886660 12:108669776-108669798 TAAGGTATTAAGAAGCAGGTAGG + Intronic
1102609646 12:114100216-114100238 TTAAGTTTCTAGAAGCAGGAAGG + Intergenic
1103145844 12:118595202-118595224 TGAGGTTTTAAAAAGCAGGAGGG + Intergenic
1103156578 12:118690138-118690160 TTATGTTTCAATAAAAAGGAAGG - Intergenic
1107024646 13:35787402-35787424 TAAGTTATCCACAAGCAGGATGG - Intronic
1107234941 13:38156771-38156793 TTATGCATCAATAGGCAGAAGGG - Intergenic
1110616414 13:77547047-77547069 TTAGATATCAGTAAGAAAGAAGG + Intronic
1115293386 14:31798141-31798163 ATAGGAATGAATCAGCAGGATGG - Intronic
1126042538 15:44606405-44606427 TTTGGAATCAAAAAGCAAGAGGG + Intronic
1126221311 15:46216980-46217002 TTAGCTATCAATAAGCTTTACGG + Intergenic
1128860404 15:71065963-71065985 ATAGGTATCATTAAGCATCATGG + Intergenic
1135804495 16:25530041-25530063 TAAAGTATCAATAAACAGAATGG + Intergenic
1141261245 16:82455674-82455696 TTATGTATACAGAAGCAGGAAGG - Intergenic
1144939815 17:18930809-18930831 TTAGGAATCAATAAGAAGTGAGG - Exonic
1147128905 17:38394238-38394260 TTTGGCATCAATCAGCAGGCGGG + Intronic
1153446436 18:5178187-5178209 ATGCATATCAATAAGCAGGAGGG - Intronic
1153695598 18:7637707-7637729 TCAGGCATGAATAAGCAAGATGG + Intronic
1155062497 18:22241261-22241283 GCAGGTACGAATAAGCAGGAGGG + Intergenic
1155278614 18:24215058-24215080 TTATGTATCACAGAGCAGGAAGG - Intronic
1156559004 18:38100491-38100513 TCAAGGATCAATAAGCAGTAGGG + Intergenic
1156583081 18:38401173-38401195 GTAGGTCTAAATATGCAGGACGG + Intergenic
1157958144 18:52122105-52122127 TTAGGTATAAATTAGCTGGGGGG - Intergenic
1159408327 18:68035750-68035772 TTAGGTATCAATAATCTCTATGG + Intergenic
1159515824 18:69456542-69456564 TTAGGTATCCATCAGCAGTAAGG - Intronic
1162467784 19:10852859-10852881 TTATGGGTCAAGAAGCAGGAGGG + Intronic
1162619430 19:11829394-11829416 GTAGGTAGCAAAGAGCAGGAGGG - Intronic
1162628159 19:11902692-11902714 GTAGGTAGCAAAGAGCAGGAGGG - Intronic
1164531069 19:29048624-29048646 TTCTGTATCTACAAGCAGGAAGG - Intergenic
926388109 2:12358642-12358664 GCAGGTATAAATAAGCAGGAAGG - Intergenic
929292391 2:40208448-40208470 TCAGGTATCACTGGGCAGGAAGG + Intronic
931082819 2:58794653-58794675 GTTGGTATCAAAAAGCAGGTAGG - Intergenic
932697664 2:73970208-73970230 TTATGAATGAATAAGCAGCATGG + Intergenic
933415588 2:81982961-81982983 TTAACTATCAATAAGTAGCAGGG + Intergenic
933887407 2:86731602-86731624 TTAGGCATCACTAAGAAGGCTGG - Intronic
933922768 2:87065111-87065133 TTAGGCATCACTAAGAAGGCTGG + Intergenic
936960460 2:118068438-118068460 ATATGTATCAATAAGAAGCAAGG + Intergenic
939411020 2:141824753-141824775 TTAAGTATCAGTGAGCAGGTGGG - Intronic
939828633 2:147046029-147046051 TTTGGAATCAATAGGCAGAAAGG - Intergenic
942068598 2:172295041-172295063 TCAGGTAGCAGAAAGCAGGAAGG + Intergenic
945436458 2:209824346-209824368 TTAGGTATGAAGAAGCAGCATGG + Intronic
1169346174 20:4829576-4829598 TTAAGTATTACTCAGCAGGAGGG - Intergenic
1169598627 20:7229907-7229929 GAAGGTATCAATAAGCTGGCTGG - Intergenic
1169661877 20:7987985-7988007 TTAGGGAACAGTAAGCATGAAGG - Intronic
952962669 3:38602463-38602485 ATTGGTATTAGTAAGCAGGAAGG - Intronic
960639774 3:119814108-119814130 TTAGGGATCTAAAAGAAGGATGG + Intronic
962563716 3:136635033-136635055 TTTGGTATAATTAAGCAGTAAGG - Intronic
964452460 3:156825364-156825386 GTAGTTATCAATAAGCAGTTTGG + Intergenic
967934588 3:194716677-194716699 TTAGCTTTCAATGAGCAGCATGG + Intergenic
968262645 3:197337618-197337640 TTACCGATCAATTAGCAGGAAGG + Intergenic
974186718 4:58456718-58456740 TTACATGTGAATAAGCAGGAGGG - Intergenic
976723177 4:88190224-88190246 TTAGGCATCAAAGAGAAGGAAGG - Intronic
979170548 4:117596550-117596572 TTAGGCATGTATAAGCCGGAAGG + Intergenic
982938905 4:161523319-161523341 TTATGTATATATAGGCAGGAAGG + Intronic
985389216 4:189477820-189477842 TTAGGTAGCAATGAGAAGAACGG + Intergenic
987916716 5:24224845-24224867 TTAGGTAACAATCAACATGACGG - Intergenic
989229249 5:39067519-39067541 GTAGGAATCAATAAGAAGAAAGG - Intronic
990368298 5:55092101-55092123 TTAGGTATCAACAACCGAGAAGG + Intergenic
992315021 5:75543697-75543719 TTAGGTATCAATAAGCAGGAAGG + Intronic
995713394 5:115057406-115057428 TTGGGTAAGAATCAGCAGGATGG - Intergenic
997138798 5:131355895-131355917 TTAGGTGGCAAAAAGGAGGAGGG + Intronic
997725649 5:136118004-136118026 TTTGGAGTCAACAAGCAGGAAGG - Intergenic
999932749 5:156451335-156451357 ATAGATTTCAACAAGCAGGAAGG + Intronic
1000204261 5:159042730-159042752 TAAGATATTAATAAGTAGGAGGG - Intronic
1003970689 6:11296371-11296393 TTAAGTATAATGAAGCAGGATGG + Intronic
1005176032 6:23045583-23045605 TTAGTTACCAATTTGCAGGATGG - Intergenic
1009745987 6:67816504-67816526 TTTGGTTTTAAAAAGCAGGAGGG + Intergenic
1012379134 6:98599263-98599285 TTAAGTATCAATAAGCAGCATGG - Intergenic
1013144522 6:107374814-107374836 ATAAGTAAAAATAAGCAGGAAGG - Intronic
1022323872 7:29312282-29312304 TGAGGTAGGAAGAAGCAGGAGGG - Intronic
1022443058 7:30449491-30449513 CTAGCTATCAGTAAGAAGGAAGG - Intronic
1022995190 7:35748178-35748200 TTACCCACCAATAAGCAGGAAGG + Intergenic
1024454988 7:49595359-49595381 TTATGGATCAATGAACAGGAAGG + Intergenic
1027554781 7:79649573-79649595 AAAGGTATAAATAAGCTGGAGGG + Intergenic
1030184891 7:106751747-106751769 TGAGGTCTCCAAAAGCAGGAAGG - Intergenic
1031414428 7:121478700-121478722 TTAGGTATGATTAGGCAGGCAGG - Intergenic
1036082846 8:5576393-5576415 GTAAGTATCAATAAGCAGGTGGG - Intergenic
1037237345 8:16736358-16736380 TTTGGTCTCAAAAAGCAGTAGGG - Intergenic
1038588103 8:28809777-28809799 TTTGATTTCAATAACCAGGAAGG + Intronic
1038807558 8:30809361-30809383 TTATGTATCAACAAGGAGGATGG + Intronic
1042532184 8:69827342-69827364 GTAGGTATTAATAAGAAGCAAGG - Intronic
1043230367 8:77792740-77792762 TTAGGAATTTATAAACAGGATGG + Intergenic
1043791839 8:84478788-84478810 TTAGGAATCAATACACAGGCTGG + Intronic
1044550663 8:93508813-93508835 ATAGGTACAAATAAGCAGAAAGG + Intergenic
1044722861 8:95167753-95167775 TTGAGTATCAACAAGCAGCAGGG - Intergenic
1044879207 8:96705492-96705514 TTAGGTATCAGGAAGCAGATGGG + Intronic
1048180705 8:132192007-132192029 TTAGATTTCAATCAGCCGGATGG - Intronic
1052037938 9:23704591-23704613 TTAGTACTCTATAAGCAGGATGG + Intronic
1057262762 9:93594612-93594634 TTAGCTGCCAATCAGCAGGAGGG - Intronic
1058079816 9:100689901-100689923 AGAGGTAACAATAAGAAGGAGGG + Intergenic
1194773675 X:97936262-97936284 TTAGATATAAATCTGCAGGAAGG - Intergenic
1198834761 X:140793336-140793358 TCTGGTAGCAATAAACAGGATGG - Intergenic
1200924992 Y:8646442-8646464 GTATGCATCAATAATCAGGAAGG - Intergenic