ID: 992315295

View in Genome Browser
Species Human (GRCh38)
Location 5:75546628-75546650
Sequence CACCCCCACAACATGTTTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 186}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992315283_992315295 -4 Left 992315283 5:75546609-75546631 CCTGCCCCACCCCACCCCCCACC 0: 1
1: 14
2: 224
3: 1704
4: 8263
Right 992315295 5:75546628-75546650 CACCCCCACAACATGTTTTTTGG 0: 1
1: 0
2: 2
3: 28
4: 186
992315286_992315295 -10 Left 992315286 5:75546615-75546637 CCACCCCACCCCCCACCCCCACA 0: 3
1: 33
2: 306
3: 1863
4: 9919
Right 992315295 5:75546628-75546650 CACCCCCACAACATGTTTTTTGG 0: 1
1: 0
2: 2
3: 28
4: 186
992315285_992315295 -9 Left 992315285 5:75546614-75546636 CCCACCCCACCCCCCACCCCCAC 0: 4
1: 36
2: 367
3: 1819
4: 9394
Right 992315295 5:75546628-75546650 CACCCCCACAACATGTTTTTTGG 0: 1
1: 0
2: 2
3: 28
4: 186
992315284_992315295 -8 Left 992315284 5:75546613-75546635 CCCCACCCCACCCCCCACCCCCA 0: 4
1: 47
2: 488
3: 2433
4: 18355
Right 992315295 5:75546628-75546650 CACCCCCACAACATGTTTTTTGG 0: 1
1: 0
2: 2
3: 28
4: 186
992315282_992315295 -1 Left 992315282 5:75546606-75546628 CCTCCTGCCCCACCCCACCCCCC 0: 2
1: 11
2: 140
3: 1120
4: 7206
Right 992315295 5:75546628-75546650 CACCCCCACAACATGTTTTTTGG 0: 1
1: 0
2: 2
3: 28
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992315295 Original CRISPR CACCCCCACAACATGTTTTT TGG Intronic
901365698 1:8746322-8746344 CACCCAAACTACATGTTATTAGG - Intronic
902564490 1:17302043-17302065 CGCCCCCACGACCTGGTTTTGGG + Intergenic
904976106 1:34457828-34457850 CACCCCCATAATATGTTTTGGGG + Intergenic
906580135 1:46929344-46929366 CACCCCCACGACCTGGTGTTGGG - Exonic
906603592 1:47149549-47149571 CACCCCCACAACCTGGTGTTGGG + Exonic
907982910 1:59502337-59502359 CAATCCAACAGCATGTTTTTTGG - Intronic
908260716 1:62337753-62337775 CACTCCCACAAAATGGTTCTGGG - Intergenic
908831260 1:68180780-68180802 CACCCCCACAACCTGGTGTTGGG + Intronic
909411273 1:75354652-75354674 CACCCCCACGACCTGGTGTTGGG + Intronic
911213609 1:95167986-95168008 CACCCCCACGACCTGGTGTTGGG + Intronic
911296183 1:96118049-96118071 CACCCCCACCCCCTTTTTTTTGG - Intergenic
911609358 1:99943894-99943916 CACGCCCACAACCTGGTGTTGGG + Intergenic
913648196 1:120882282-120882304 CACCCCTACCTCATGTTTTTTGG + Intergenic
913681062 1:121187091-121187113 CAGCCCCACACCATGTTGTGCGG + Exonic
914032892 1:143974731-143974753 CAGCCCCACACCATGTTGTGCGG + Intergenic
914078491 1:144381001-144381023 CACCCCTACCTCATGTTTTTTGG - Intergenic
914100688 1:144585501-144585523 CACCCCTACCTCATGTTTTTTGG + Intergenic
914156554 1:145093235-145093257 CAGCCCCACACCATGTTGTGCGG - Exonic
914173402 1:145249549-145249571 CACCCCTACCTCATGTTTTTTGG - Intergenic
914298297 1:146352148-146352170 CACCCCTACCTCATGTTTTTTGG - Intergenic
914528055 1:148490686-148490708 CACCCCTACCTCATGTTTTTTGG - Intergenic
914638332 1:149576381-149576403 CACCCCTACCTCATGTTTTTTGG + Intergenic
914994559 1:152531405-152531427 CACCCCCACGACCTGGTGTTGGG - Intronic
915006180 1:152639146-152639168 AACCCCCACAACATGCAATTTGG - Intergenic
915206855 1:154276456-154276478 CACACCCACACCCTTTTTTTGGG - Intergenic
916195588 1:162219327-162219349 AAACCCCAGAATATGTTTTTAGG + Intronic
916210751 1:162357768-162357790 CAGCCCCCGAACAAGTTTTTTGG - Intronic
917598072 1:176549840-176549862 CACCCCCACAACATTTACTGAGG + Intronic
918378786 1:183934476-183934498 CACGCCCACATGATGTTTTGTGG - Intronic
920468374 1:206205615-206205637 CAGCCCCACACCATGTTGTGCGG + Intronic
922522920 1:226272964-226272986 CACCCCCACGACCTGGTGTTGGG + Intronic
923951047 1:238954341-238954363 CACCCTTAGAACATGTTATTTGG + Intergenic
924275807 1:242385619-242385641 CACCCCCACGACCTGGTGTTGGG + Intronic
924334934 1:242978126-242978148 CACCACCAAAAGATGTTTTGGGG - Intergenic
1064607846 10:17062655-17062677 CAGCCCCAAAATATGTGTTTGGG - Intronic
1068780654 10:60916137-60916159 CACCTCCACCACATTCTTTTGGG - Intronic
1070920849 10:80185100-80185122 CACTCCCACAATATGCATTTTGG + Intronic
1074958151 10:118412732-118412754 CACCACAACAAAATGTATTTGGG + Intergenic
1076152575 10:128174701-128174723 CACCCCCACAACCTGGTGTTGGG - Intergenic
1077955390 11:7013712-7013734 CACCCCCACGACCTGGTGTTGGG + Intronic
1078935799 11:15948854-15948876 CAGCCCCATAGCATGTCTTTGGG + Intergenic
1079254663 11:18817751-18817773 CACCCCCACAACCTGGTATTGGG - Intergenic
1079255175 11:18821732-18821754 CACCCCCACAACTTGGTTTTGGG - Intergenic
1080559047 11:33445220-33445242 CACCCCCACAACAGAGGTTTGGG - Intergenic
1083585729 11:63857467-63857489 CACCGCCCCAGCCTGTTTTTTGG + Intronic
1084732299 11:71081469-71081491 CACTCTCATAACATGATTTTTGG + Intronic
1086748143 11:90455892-90455914 CACCCCCACGACCTGGTGTTGGG + Intergenic
1088931690 11:114357729-114357751 CACCCCCACGACCTGGTGTTGGG + Intergenic
1089663644 11:120002464-120002486 CTCCCCCACACCATCTTTTTTGG - Intergenic
1091407023 12:215400-215422 CACCCCCACGATATGTCTCTCGG + Intergenic
1092607612 12:10137246-10137268 CACCCCCACGACCTGGTGTTGGG + Intergenic
1093302360 12:17472576-17472598 CACCCCCACGACCTGGTGTTGGG + Intergenic
1093348243 12:18067031-18067053 CACCCCCACGACCTGGTGTTGGG + Intergenic
1094436142 12:30422841-30422863 CACCCCCACCACAGGCTTCTTGG + Intergenic
1094783414 12:33818712-33818734 CACCCCCACGACATGGTGTTGGG - Intergenic
1097880046 12:64678677-64678699 CAGCCCCACAAGAGGTTTTTGGG - Intronic
1097901453 12:64877618-64877640 CACGCCTACAGCCTGTTTTTTGG + Intronic
1099471179 12:83050296-83050318 TACCCTCACAATATGTTTCTGGG + Intronic
1100644076 12:96510567-96510589 CATCCTCATCACATGTTTTTTGG + Intronic
1101089177 12:101267088-101267110 CACTCCCACAGCATTTTGTTGGG - Intergenic
1101265866 12:103086594-103086616 AACCTCCAAAACATGTTTTCAGG - Intergenic
1102586227 12:113924865-113924887 CATCACCTCAAAATGTTTTTGGG - Intronic
1102619153 12:114180019-114180041 CATCACCACAAGATGTTCTTTGG - Intergenic
1102648501 12:114419641-114419663 CTCCCCCGCAGCATGTTTTTTGG + Intergenic
1107038205 13:35922263-35922285 CACCCCCAAGAAATGTTTATTGG - Intronic
1109606447 13:64704355-64704377 CAACCCCACAACCTGGTGTTGGG - Intergenic
1110489982 13:76091981-76092003 CAGCCCCAACACATTTTTTTCGG - Intergenic
1111605587 13:90534687-90534709 AACCTCAACAACATGTCTTTGGG + Intergenic
1113723412 13:112578839-112578861 CACCCCCACGACCTGGTGTTGGG + Intronic
1121830589 14:97048300-97048322 CACCCATACAACATTTTTTATGG - Intergenic
1122749806 14:103924474-103924496 CACACACACACAATGTTTTTTGG + Intronic
1123176078 14:106420450-106420472 CAACACCACATCATGTTTTAAGG - Intergenic
1202947607 14_KI270726v1_random:43113-43135 CAACACCACATCATGTTTTAAGG + Intergenic
1124459411 15:29875528-29875550 AAAACCCACAACATGTATTTGGG - Intronic
1124570067 15:30854748-30854770 CACCCCAAAACCATGTCTTTAGG + Intergenic
1124675945 15:31686060-31686082 CACACCCAGAACTTGGTTTTGGG - Intronic
1126353726 15:47772334-47772356 CACACACACAACAAGTTTGTTGG - Exonic
1127077097 15:55337574-55337596 CACCCCCGCAACCTGTTTGTGGG + Intronic
1127347265 15:58113260-58113282 CACCCCCACGACCTGGTGTTGGG - Intronic
1127946768 15:63763174-63763196 CACCCCCACGACCTGGTGTTGGG + Intronic
1129220992 15:74131480-74131502 CCCTCCCACAACTTGTCTTTGGG - Intronic
1129392737 15:75228741-75228763 CACCCCCACATCCTGGTTCTGGG + Intergenic
1130693755 15:86109600-86109622 CAGCTCCACAATTTGTTTTTTGG + Intergenic
1133101731 16:3484157-3484179 CACACGCACAGCATTTTTTTGGG - Intronic
1133695485 16:8258677-8258699 CAAGCCCATATCATGTTTTTTGG + Intergenic
1134155067 16:11836293-11836315 CACCCCCACGACCTGGTGTTGGG + Exonic
1139458529 16:67103809-67103831 CACCCTCAAAACATCTCTTTAGG - Intergenic
1141026523 16:80553989-80554011 CATCCCCAAAAATTGTTTTTAGG + Intergenic
1145364106 17:22239947-22239969 CAACCCCACAACCTGGTGTTGGG + Intergenic
1147702777 17:42406254-42406276 CACTCCCACCACTTGCTTTTCGG - Intronic
1147754608 17:42760540-42760562 CCTCCCCACAACAGGTTTGTGGG + Intronic
1154335935 18:13464790-13464812 CACCCCCACCCCAAGGTTTTAGG + Intronic
1157131234 18:45009185-45009207 CAACCTCACAAAATGCTTTTTGG + Intronic
1158694801 18:59694612-59694634 CAGCCGCACAGCATGATTTTGGG - Intronic
1159610970 18:70525185-70525207 CACCCCCACGACCTGGTGTTGGG + Intergenic
1160254823 18:77239539-77239561 CACCCCCATAACCTAGTTTTGGG + Intergenic
1162482387 19:10935800-10935822 CTCCCCCACACCTTGTTTTCAGG + Intergenic
1163887122 19:19975842-19975864 CACCCCCACGACCTGGTGTTGGG - Intergenic
1163901345 19:20103024-20103046 CACCCCCACGACCTGGTGTTTGG - Intronic
1163962436 19:20709744-20709766 CACCCCCACAACCCGGTGTTGGG - Intronic
1163962784 19:20712774-20712796 CACCCCCACGACCTGGTGTTGGG - Intronic
1164000723 19:21095819-21095841 CACCCCCACGACCTGATGTTGGG + Intronic
1165602270 19:37064840-37064862 CACCCCCACGACCTGGTGTTGGG - Intronic
928984898 2:37171256-37171278 CAGCCCCATACCATCTTTTTTGG - Intronic
930402109 2:50903565-50903587 CACCCCCACAACATACCTTATGG + Intronic
933060720 2:77734329-77734351 CCCACCCACAACCTGCTTTTTGG + Intergenic
933186045 2:79280310-79280332 CATCCCCCTCACATGTTTTTAGG - Intronic
934130565 2:88944262-88944284 CACCCCCACGACCTGGTGTTGGG + Intergenic
934858000 2:97740839-97740861 CACCCCCACGACCTGGTGTTGGG - Intergenic
936144662 2:109972449-109972471 CACCCCCACAACCTGGTGTTGGG - Intergenic
936181347 2:110270412-110270434 CACCCCCACAACCTGGTGTTGGG - Intergenic
936200025 2:110399020-110399042 CACCCCCACAACCTGGTGTTGGG + Intergenic
936800668 2:116261166-116261188 CACCATGACAACAGGTTTTTGGG - Intergenic
937558938 2:123196588-123196610 TACCCCCAAAATATGTTTTTTGG + Intergenic
942344979 2:174993237-174993259 CACCCCCACAACCTGCTTCATGG + Intronic
942816176 2:180056900-180056922 CACCCCCACGATCTGTTGTTGGG + Intergenic
943238402 2:185352774-185352796 CATCTCCTAAACATGTTTTTTGG - Intergenic
945559873 2:211326632-211326654 TAAACCCACAACATGTTTTCTGG + Intergenic
946409910 2:219510730-219510752 CACCCCCACCCCATCTTTCTAGG - Intergenic
947614295 2:231545266-231545288 CACCCCCTCACCATGCTTTCTGG + Intergenic
947952878 2:234163173-234163195 CACACACACACCATCTTTTTTGG - Intergenic
948378791 2:237539208-237539230 CACCTCCACAACCTGTTCTCAGG - Intronic
1171570782 20:26249388-26249410 CACCACCACATCTTATTTTTTGG + Intergenic
1173350651 20:42242331-42242353 CTCCCATTCAACATGTTTTTAGG + Intronic
1176334858 21:5586793-5586815 CACCCCATCAGAATGTTTTTGGG - Intergenic
1176392899 21:6234155-6234177 CACCCCATCAGAATGTTTTTGGG + Intergenic
1176468520 21:7082019-7082041 CACCCCATCAGAATGTTTTTGGG - Intronic
1176492081 21:7463797-7463819 CACCCCATCAGAATGTTTTTGGG - Intergenic
1176508561 21:7674586-7674608 CACCCCATCAGAATGTTTTTGGG + Intergenic
1177322878 21:19544968-19544990 CACCCCCACGACCTGGTGTTGGG + Intergenic
1177501660 21:21964586-21964608 CACCCCCACGACCTGGTGTTGGG - Intergenic
1178661937 21:34514212-34514234 CAGCCACAGAACATGTTTCTAGG - Intronic
1178981511 21:37268305-37268327 CACCCCCACAAACTGTATCTGGG - Intergenic
1179638686 21:42732331-42732353 CACCCACTCAACATGGTCTTTGG - Intronic
1182039573 22:27226044-27226066 CACACCTAGAACATGTATTTTGG - Intergenic
1182709825 22:32314008-32314030 CAACCAAACTACATGTTTTTTGG + Intergenic
1183034976 22:35134595-35134617 CTCCCCCACACCAGGGTTTTGGG + Intergenic
949970475 3:9398528-9398550 CACCCCCACCACACGTTCTCTGG + Intronic
951029246 3:17863115-17863137 CACCCCCACTACAAGTCTGTGGG + Intronic
953109365 3:39918756-39918778 TACCACCATAACCTGTTTTTTGG - Intronic
955157860 3:56434899-56434921 CTCCCCCACTACTTGTTCTTCGG + Exonic
955226006 3:57060847-57060869 CACCACCACCACTTCTTTTTTGG + Intronic
955381859 3:58445288-58445310 CACCCCCACGACCTGGTGTTGGG + Intergenic
957099735 3:75812014-75812036 CACCCCCACAACCTAGTGTTGGG - Intergenic
957104749 3:75872514-75872536 CACCACCACATCTTATTTTTTGG - Intergenic
957319831 3:78615712-78615734 GACCGCGACAACATGTCTTTTGG + Intronic
959657246 3:108821743-108821765 CTCCCCCCCAAAATATTTTTTGG - Intergenic
961167938 3:124776423-124776445 CACCCCCCCAACATTTTGTTAGG + Intronic
965122111 3:164573418-164573440 CACTCTCACAACATGTTATCTGG + Intergenic
965825460 3:172724706-172724728 CACCCCCACGACCTGGTGTTGGG + Intergenic
967184874 3:186935972-186935994 CACTCCCACCACCTGTTTGTCGG - Intronic
969649233 4:8453969-8453991 CACCCCCACAACCAGCTTATAGG - Intronic
970749515 4:19340911-19340933 CCCACACACAACATGTTTTCTGG + Intergenic
973695887 4:53490656-53490678 TTCCCAGACAACATGTTTTTTGG - Intronic
978306575 4:107334755-107334777 CACCCCCACGACCTGGTGTTGGG + Intergenic
978785153 4:112600994-112601016 CACCCCTACAACCTGGTGTTGGG + Intronic
982944527 4:161603248-161603270 GACCCACACAATTTGTTTTTTGG + Intronic
983182330 4:164662955-164662977 CACCCCCACGACCTGGTGTTGGG + Intergenic
983998689 4:174215083-174215105 CACCCCCATAAAATATTATTAGG - Intergenic
984938302 4:184909097-184909119 CACCCCCACGACCTGGTGTTGGG - Intergenic
984938718 4:184912737-184912759 CACCCCCACGACCTGGTGTTGGG - Intergenic
986316602 5:6593177-6593199 CACCCCCACGACCTGGTGTTGGG - Intergenic
986477700 5:8152679-8152701 CACCCCCACCTCCTTTTTTTTGG - Intergenic
987612533 5:20224986-20225008 CAGCCCCAAAACATTTTTCTAGG + Intronic
988457408 5:31398611-31398633 CGCCCCCACAACCTGGTGTTGGG - Intergenic
989979465 5:50625846-50625868 CACCCCTACCTCATGTTTTTTGG + Intergenic
990656019 5:57956229-57956251 CAAGACCACAACATGTTATTTGG - Intergenic
992315295 5:75546628-75546650 CACCCCCACAACATGTTTTTTGG + Intronic
992674444 5:79091882-79091904 CCCCCTCACAACATCTGTTTGGG - Intronic
993161465 5:84297518-84297540 CACCCCCACGACCTGATGTTGGG - Intronic
993477239 5:88380685-88380707 CACCCCCACGACCTGGTGTTGGG + Intergenic
996678995 5:126209406-126209428 CACCCCCACTTCTTGTTTTTAGG - Intergenic
1002828108 6:792133-792155 CTCACCCACAACAGGTTTTGCGG + Intergenic
1006778642 6:36616746-36616768 CATCACCCCAACATGTTTATAGG + Intergenic
1007595303 6:43047415-43047437 CAGCCCTACAACTGGTTTTTGGG - Intronic
1007976845 6:46110364-46110386 CACCCCCACGACCTGGTGTTGGG + Intergenic
1013211502 6:107990930-107990952 CGCCCCCACAACCTGGTATTGGG + Intergenic
1013471550 6:110470952-110470974 CACCCTCACAAGCTGTTTATTGG - Intronic
1014813541 6:125910965-125910987 CACCCCCACGACCTGGTGTTGGG - Intronic
1015408445 6:132864095-132864117 CACCCCCACTTCCTGTTTTCTGG + Intergenic
1016222774 6:141695659-141695681 CACTGCCAGAACATGTATTTTGG - Intergenic
1016679206 6:146808851-146808873 CACCCCCACGACCTGGTGTTGGG - Intronic
1016679771 6:146815795-146815817 CACCCCCACGACCTGGTGTTGGG - Intergenic
1017861788 6:158405293-158405315 CACCCCCACGACCTGGTGTTGGG - Intronic
1018687840 6:166317615-166317637 CACCCCCACGACCTGGTGTTGGG + Intergenic
1018691124 6:166344943-166344965 CACTCCCACAACCTGGTGTTGGG - Intergenic
1020507853 7:9017067-9017089 CACCCCCACGACCTGGTGTTGGG + Intergenic
1023265501 7:38401266-38401288 AACCCCCAAAACATGTTTAATGG - Intronic
1023910638 7:44553289-44553311 CACCCCCACGACCTGGTGTTGGG + Intergenic
1028444806 7:90909437-90909459 CACCCCCGCAACATGCTTCACGG + Intronic
1029952331 7:104600146-104600168 TCTCCCCTCAACATGTTTTTAGG - Intronic
1030443830 7:109624361-109624383 CACCCCCACGACCTGGTGTTGGG - Intergenic
1031580077 7:123462941-123462963 TACCCCCACAACCACTTTTTGGG - Intronic
1032896788 7:136260560-136260582 CGCCCCCACAACCTGGTGTTGGG - Intergenic
1032897210 7:136264412-136264434 CACCCCCACGACCTGGTGTTGGG - Intergenic
1034027625 7:147723940-147723962 CACCTCCACAGAATGCTTTTTGG + Intronic
1034372817 7:150615191-150615213 CACCCCCACCACCTGGTGTTGGG - Intergenic
1034423629 7:151001729-151001751 CCCCCTCACAACAGGGTTTTGGG - Intronic
1034567874 7:151929984-151930006 GACCTCAGCAACATGTTTTTAGG + Intergenic
1039550869 8:38441981-38442003 CAGCCCCAAAACATGTTTCTGGG - Intronic
1042708571 8:71689212-71689234 CTCCCCCATTACATGTTTTTTGG + Intergenic
1043749115 8:83912793-83912815 CACCCCCACAACCTGGTTTTGGG + Intergenic
1044404154 8:91808297-91808319 TACCTTCACAACATTTTTTTTGG + Intergenic
1048694768 8:137013237-137013259 CACCCCCACAACCTTGTGTTTGG - Intergenic
1050165138 9:2757636-2757658 CACCACAATAACCTGTTTTTTGG + Intronic
1051188214 9:14482452-14482474 CACCCCCTCACCATGTTCTTAGG + Intergenic
1055393391 9:75847426-75847448 CTCCCCCACCCCATGCTTTTTGG - Intergenic
1058119506 9:101123450-101123472 CACCCCCACGACCTGGTGTTGGG - Intronic
1060493581 9:124102101-124102123 GACCTCCACAACACGTTTTGTGG - Intergenic
1060846890 9:126844614-126844636 CACCACCATAACTGGTTTTTTGG + Intergenic
1190053154 X:47166628-47166650 CACCACCACAACATATTAGTTGG - Intronic
1190406847 X:50096753-50096775 CACCCCTACAACATATGTTCTGG + Exonic
1196943366 X:120799464-120799486 CCCCCCCACCTCATATTTTTAGG + Intergenic
1197083014 X:122441121-122441143 CACCCACACAACAAGCTTCTAGG - Intergenic
1198465258 X:136899088-136899110 CACCCCCACAACCTGGTGTTGGG + Intergenic
1200036690 X:153335485-153335507 CATCCCCACAAAATGTTACTAGG + Intronic
1200377855 X:155803276-155803298 CACCCCCACAACCTGGTGCTGGG - Intergenic