ID: 992317154

View in Genome Browser
Species Human (GRCh38)
Location 5:75567812-75567834
Sequence ACAGAGGAACAGCCTGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 499
Summary {0: 1, 1: 0, 2: 7, 3: 53, 4: 438}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992317149_992317154 16 Left 992317149 5:75567773-75567795 CCTTGAAGGCTTGTGACAGAGCT 0: 1
1: 0
2: 0
3: 11
4: 172
Right 992317154 5:75567812-75567834 ACAGAGGAACAGCCTGAGGAAGG 0: 1
1: 0
2: 7
3: 53
4: 438

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992317154 Original CRISPR ACAGAGGAACAGCCTGAGGA AGG Intronic
900207178 1:1436535-1436557 TCAGAGGAGCAGCCTGAGGCTGG - Intronic
900390079 1:2430004-2430026 ACAGAGAAACAGCTGGAGCATGG + Intronic
900900175 1:5510705-5510727 GCAGATGAGCAGACTGAGGAAGG + Intergenic
901574679 1:10191358-10191380 ACAGAGAAACAGCAGGAGCAAGG + Intergenic
901769526 1:11523171-11523193 TCATGGGAACAGCCTCAGGATGG + Intronic
901780891 1:11593885-11593907 GCAGAGGGAGAGCCAGAGGACGG + Intergenic
902226189 1:14997798-14997820 ACAGAGCAACAGCATCAGGTGGG + Intronic
902511044 1:16967351-16967373 ATAGAGGGACAGGCTGGGGAGGG - Intronic
902801537 1:18833027-18833049 ACAGAGGAGCAGCCTGGGCAAGG - Intergenic
903699794 1:25238609-25238631 TCAGAGGAAGAGTCTGAGGATGG - Intergenic
903834104 1:26191494-26191516 ACAGATGAGGAGCCTGAGGCCGG - Intronic
904211898 1:28891351-28891373 TCAGAGGAAGAGACTGAGGTTGG + Intronic
904291024 1:29485903-29485925 ACAGATGGACACACTGAGGAGGG + Intergenic
904696526 1:32334799-32334821 ACAGAGGAAGAGCAGGAGCAGGG - Exonic
904833194 1:33318766-33318788 ACAGAGGCACATCCTGGGGGAGG - Intronic
904844341 1:33397607-33397629 CCAGAGGAACAGACTCAGGAGGG - Intronic
904991773 1:34598931-34598953 ACAGAGGAACAGCAAGAGGAGGG - Intergenic
905122896 1:35695441-35695463 AAAGAAGAACAGGCAGAGGAGGG - Intergenic
906127800 1:43438210-43438232 ACTGAGGCACAGCTTGGGGAAGG + Intronic
906331040 1:44884430-44884452 ACAGAGGCAGAGGCTGAGGAGGG + Intronic
906448468 1:45923122-45923144 ACAGAGGAACAGGCAGAGAGGGG - Intronic
907418915 1:54333351-54333373 GCAGAGCTACAGCCTGAGCATGG - Intronic
907823190 1:57990635-57990657 CCAGAGGTCCAGACTGAGGACGG + Intronic
908748848 1:67400746-67400768 ACATAGCAAAAGACTGAGGAGGG - Intergenic
909135081 1:71787977-71787999 ACAGAGTAACTGCCTTAGAAAGG + Intronic
909555465 1:76948977-76948999 AGAGAAGCACAGCCTCAGGATGG - Intronic
910170163 1:84368753-84368775 AGGGAGGCACAGCCAGAGGAAGG + Intronic
910438715 1:87230995-87231017 ACAGAGAAACAGTCTGAAAAAGG - Intergenic
910613622 1:89171932-89171954 ACAGAGGAACGCCCTGAACATGG - Exonic
911697504 1:100907798-100907820 AGAGAGTAAGAGGCTGAGGAAGG - Intronic
912503123 1:110135660-110135682 AGAGAGGAAGAGCCTCAGGCTGG + Intergenic
912812130 1:112802562-112802584 CCAGAGGAACAGCCCAGGGAGGG + Intergenic
914357560 1:146899869-146899891 ACAAATGACCAGCCTGAAGAAGG - Intergenic
914357827 1:146902967-146902989 ATAGAGGAAAAGCAGGAGGAAGG - Intergenic
915632952 1:157166164-157166186 ACAGAGGTAGAGGATGAGGATGG - Intergenic
915645074 1:157264745-157264767 AGAGATGAACAGAATGAGGACGG + Intergenic
916457851 1:164989357-164989379 ACAGAGGAGGTGCCTGGGGAGGG - Intergenic
917470782 1:175324173-175324195 ACAGAGTAGAAGCCAGAGGAAGG - Intronic
917566655 1:176219314-176219336 AGAGAGAAACAGCCTAAGAATGG - Intergenic
917791954 1:178504623-178504645 CCAGAGGAACAGCAGGATGAAGG + Intergenic
918095472 1:181330456-181330478 CCAGAGGGTCAGCCTGGGGAAGG + Intergenic
918203782 1:182291318-182291340 GCAGAAAAACAGGCTGAGGATGG + Intergenic
918814714 1:189168016-189168038 CCAGAGGAACAGTTTAAGGATGG + Intergenic
919513573 1:198494774-198494796 ACAGAGGAACAGGCAGAGAAGGG - Intergenic
921374536 1:214460148-214460170 ACATAGGAACAGCAAGAGTAGGG + Intronic
922706490 1:227793361-227793383 ACAGAGGCACAGCCTGATGTGGG + Intergenic
923619170 1:235563881-235563903 ACTGCAGAACAGTCTGAGGAAGG - Intronic
1062834040 10:624406-624428 ACACAAGCACAGCCTGAGGAAGG + Intronic
1063079651 10:2753680-2753702 AAAGACCAACAGCCAGAGGATGG + Intergenic
1063450547 10:6147409-6147431 GCAGAAGCACAGCCTGGGGAGGG - Intronic
1064128930 10:12690387-12690409 ACAGAAGCACAGCCTGTAGAAGG + Intronic
1065732368 10:28721331-28721353 CCAGGGGAACAGTCTGAGGTAGG + Intergenic
1066460407 10:35608097-35608119 CCAGAGGAACAGCATCAGCAGGG - Exonic
1066500563 10:35989751-35989773 CCAGAGGAACAGTGTGGGGAGGG + Intergenic
1066609345 10:37222656-37222678 ATGGAGGAACAGCATGAGGAAGG - Intronic
1066756353 10:38716488-38716510 AGAGAGCAAGACCCTGAGGAAGG - Intergenic
1067083093 10:43222626-43222648 ACAGATGAACAGTAAGAGGAAGG - Intronic
1067315142 10:45154427-45154449 ACAGGGGAACAGCATAATGAGGG - Intergenic
1069060571 10:63890299-63890321 TCATAGGAACAGACTGATGATGG + Intergenic
1069566868 10:69469272-69469294 ACTCAGGAACAGCCAGAGGGAGG - Intronic
1069574518 10:69517181-69517203 ACACAGGAGCAGCGAGAGGAAGG - Intergenic
1071859152 10:89655001-89655023 ACAGATGAACAACCTGATGAAGG - Intergenic
1072188964 10:93065467-93065489 CCAGTGGAACAGCCTGACAATGG - Intronic
1072849396 10:98871712-98871734 GCAGAAAAACAGCCTAAGGAAGG + Intronic
1073541466 10:104319068-104319090 ACAGGGCACCAGCCTGGGGAAGG + Intronic
1075055512 10:119215510-119215532 AGTGAGGAAGAGACTGAGGAAGG + Intronic
1075653271 10:124144033-124144055 ACAGAGGTTCACTCTGAGGAGGG - Intergenic
1075721608 10:124590765-124590787 ACAGAGAAGCAGGCTCAGGAAGG - Intronic
1076100509 10:127774054-127774076 ACAGAGGAATTGCTTGGGGAGGG - Intergenic
1076294370 10:129373342-129373364 ACAGATGAGCAGCCAGAGTACGG + Intergenic
1076648469 10:131970775-131970797 AAAGAGGAACTCCCTGAGGCGGG + Exonic
1077178007 11:1199316-1199338 ACAGAGGGACAGACGGAGGGAGG + Intronic
1077218382 11:1404565-1404587 ACAGAGCACCAGCCTTGGGAGGG + Intronic
1079244629 11:18743437-18743459 ACAGGGGAGCAGGCTGAGTATGG + Intronic
1080909768 11:36583858-36583880 GCACAGGAGCAGCCTGAGGGAGG + Intronic
1081194396 11:40143515-40143537 GCAGAGGAACAGCATGTGCAAGG - Intronic
1081471236 11:43372941-43372963 ACAGAGGAATAGAGAGAGGAAGG + Intronic
1081603986 11:44515385-44515407 ACAGAGGGACAGCTGGAGGGAGG - Intergenic
1081747514 11:45483384-45483406 ACAGAGGGACAGGATGAGGTGGG + Intergenic
1082262668 11:50089329-50089351 ACAGAGGATCAGCATAATGAGGG + Intergenic
1083273798 11:61585841-61585863 ACAGAGAAACAGGCAGAGGTAGG - Intergenic
1083314599 11:61806622-61806644 ACAGGGGAGCTGCCTCAGGAGGG - Intronic
1083463877 11:62832680-62832702 AAGGAGGAAGAGTCTGAGGACGG - Intronic
1083546725 11:63554302-63554324 CCAGAGGAGAAGACTGAGGATGG + Intronic
1083815141 11:65128449-65128471 ACAGAGGAGATGCCTGAGGATGG - Exonic
1083848841 11:65353838-65353860 TCAGTGGAAAAGCATGAGGACGG - Intergenic
1084400362 11:68939695-68939717 CCAGAGGACCAGCCGGAGGAAGG + Exonic
1084466533 11:69326340-69326362 ACAGCGGAACAGACTGGGTATGG + Intronic
1085170193 11:74443283-74443305 ACATAGGAGCAGCCACAGGAGGG - Intergenic
1085764444 11:79270761-79270783 ACAGAGAGGCAGCCTGAGGCTGG - Intronic
1085958698 11:81433378-81433400 ACTGTGAAACAGCCTGAGGCAGG - Intergenic
1087070735 11:94077784-94077806 AGAGAGGAACAGAATGTGGATGG - Intronic
1087526752 11:99323922-99323944 ACAGAGGAAGAGACAGAGGGAGG + Intronic
1087608434 11:100405477-100405499 TCAGAGGGACAGCTTGAGGGTGG - Intergenic
1088047985 11:105476851-105476873 ACAGAGGAGCAGGATGAGGAAGG - Intergenic
1088792528 11:113238576-113238598 ACTGAGGACGAGCCTTAGGAAGG + Intronic
1089496541 11:118911034-118911056 ACAGATGAAAAGACTGAGGCCGG + Intronic
1090320656 11:125840538-125840560 ACAGATGCACAGCCAGATGAAGG + Intergenic
1090373801 11:126275177-126275199 ACAGAGACAAAGCCTGATGAAGG - Intronic
1090652424 11:128819268-128819290 ACAGAGGCACTGCCTGGGGTGGG - Intergenic
1090844925 11:130522483-130522505 ACAGAGGGACAGCAGGAGGGAGG + Intergenic
1091076981 11:132628582-132628604 AGAGTGGGAGAGCCTGAGGAAGG - Intronic
1091105975 11:132920356-132920378 ACAGATGAGGAGCCTGAGGAAGG - Intronic
1091214585 11:133892966-133892988 TCAGAGGAGCAGTGTGAGGAGGG - Intergenic
1091401699 12:185164-185186 CCAGAGGAAAAGGCTGAGGCTGG + Intergenic
1091544311 12:1490896-1490918 GCCGAGGAACAGAGTGAGGAAGG - Exonic
1091566151 12:1649624-1649646 ACAGATGGACAGCTAGAGGATGG + Intergenic
1092655842 12:10684677-10684699 ACAGAGCAAAAGGCAGAGGAAGG - Intergenic
1094314909 12:29128955-29128977 ACAGATGAACAGCCAGATGAAGG - Intergenic
1095624695 12:44301174-44301196 ACAGAGTAGAAGCATGAGGATGG - Intronic
1096149144 12:49297770-49297792 CCAGAGCAAGAGCCCGAGGAGGG - Intronic
1096761009 12:53841983-53842005 ACAGAGGGACAGCCCAAGGAGGG - Intergenic
1096871569 12:54595832-54595854 ACAGAGAAAGAGCCTGAGGGTGG - Intergenic
1097030136 12:56083920-56083942 AAAGAGGAGCAGGTTGAGGAAGG - Intronic
1097726458 12:63080586-63080608 ACACTGGAAAAGTCTGAGGAAGG - Intergenic
1100984287 12:100189757-100189779 GCAAAGGGACAGCCTGAGGCAGG + Intergenic
1102431689 12:112889055-112889077 CCAGATGGCCAGCCTGAGGATGG + Intronic
1102442049 12:112970976-112970998 AGAGAGAAACAGGCTGAGCACGG - Exonic
1103513380 12:121490477-121490499 CCAGAGGAAGAAACTGAGGAAGG - Intronic
1103623012 12:122200356-122200378 ACAGAAGTGCAGCCTGTGGATGG - Intronic
1104674619 12:130704153-130704175 ACAGAGGAAGTGCAGGAGGAGGG + Intronic
1105216463 13:18289491-18289513 TCAGCGGAAGAGCCTGATGAAGG + Intergenic
1105384916 13:19920669-19920691 AAAGAGGAAGGGGCTGAGGAGGG + Intergenic
1105498455 13:20951067-20951089 ACAGAGGAGCACACTGAGGTGGG + Intergenic
1105706639 13:22971427-22971449 ACAGAAGAACAGTTGGAGGAAGG - Intergenic
1105774349 13:23643624-23643646 ACACAGTAACAGGCTGAGGATGG + Intronic
1105848951 13:24317828-24317850 ACAGGGGAGCAGCCAGTGGAGGG + Intronic
1106324971 13:28680317-28680339 ACAGATGAACAGCCAGATGGAGG + Intergenic
1107555062 13:41510352-41510374 ACAGATGGACAGCCAGAGGGAGG + Intergenic
1111982281 13:95029482-95029504 GCAGAGGAACTGCGTGATGAAGG + Intronic
1112340594 13:98549764-98549786 ACAGAAGAACAGCCTGAGACAGG + Intronic
1112930469 13:104730017-104730039 ACAGAGGAAGAACATGAGCAAGG + Intergenic
1113364231 13:109661595-109661617 ACAGAGGAACATAGTGAGCAAGG + Intergenic
1113479759 13:110611909-110611931 ACAGAGGCAGAGGCTGGGGAGGG + Intergenic
1113960133 13:114121606-114121628 ACAGAGGTTCAGGCTGAGGGAGG - Intronic
1114890983 14:26922749-26922771 AGAAAGGAACAGCATGAGGAAGG + Intergenic
1115654253 14:35428109-35428131 ACAGAGAAACAGCTTGAAAATGG + Intergenic
1116662691 14:47731802-47731824 ACAGATGAACAGGATGAAGAAGG + Intergenic
1116899450 14:50347839-50347861 ACAGAGGAGCAGAAAGAGGAAGG + Intronic
1117318226 14:54595552-54595574 ACCAAGGAACAGCCTTCGGAGGG + Intronic
1117471942 14:56055242-56055264 ACAGGCGAACAGTGTGAGGACGG - Intergenic
1117488708 14:56225226-56225248 TCAGAGGCACAGGCTGAGGTGGG + Intronic
1117669049 14:58087361-58087383 ACATAGGAACATCCTCAGGGAGG + Intronic
1118299917 14:64606078-64606100 CATGAGGAACAGCCTGAGGGAGG + Intergenic
1118959224 14:70513576-70513598 AGAGAGGAACAGGGTAAGGAAGG + Intergenic
1119198831 14:72738130-72738152 ACAGGGGAAGAGACTGGGGAGGG + Intronic
1119424672 14:74527783-74527805 CCAGGGGAACAGTTTGAGGAAGG + Intronic
1119616051 14:76099793-76099815 ACAGATGACAACCCTGAGGAAGG + Intergenic
1120179191 14:81325839-81325861 ACAGAGGGGCAGACTGAGAAGGG + Intronic
1121452985 14:94021226-94021248 ATAGAGGAACTGACTGAGGCTGG + Intergenic
1121729719 14:96178061-96178083 ACAGAGAAACAGGCAGGGGAGGG + Intergenic
1122067241 14:99182297-99182319 ACAGATGAAGAAACTGAGGACGG + Intronic
1123478802 15:20612433-20612455 TGAGAGGAACAGCCACAGGAGGG + Intergenic
1123639211 15:22387952-22387974 TGAGAGGAACAGCCACAGGAGGG - Intergenic
1123686959 15:22805333-22805355 ACACCGGCACAGCCAGAGGAAGG - Intronic
1124412184 15:29445636-29445658 ACAGATGAACAGCCAGATGGAGG - Intronic
1124716553 15:32068289-32068311 ACAGAGTGAGACCCTGAGGAAGG + Intronic
1126187549 15:45845229-45845251 ATAGATGAAAAGCCTAAGGAGGG - Intergenic
1126190648 15:45874493-45874515 ACTGAGTAACAGGCAGAGGATGG - Intergenic
1126326112 15:47479333-47479355 ATAGAGAAACAGGTTGAGGATGG - Intronic
1126479205 15:49099326-49099348 CAAGTGCAACAGCCTGAGGAGGG + Intergenic
1126555476 15:49983180-49983202 TCAGAGGAACAGCATGAGCTGGG - Intronic
1127629523 15:60814167-60814189 CAAAAGGAACAGCCTGAGTAAGG - Intronic
1127631937 15:60835640-60835662 ACAGGTGAAGAGTCTGAGGATGG + Intronic
1128449136 15:67792004-67792026 ACAGAGCACCAGGCAGAGGAGGG + Intronic
1128995214 15:72290006-72290028 ACAAAGGCACAGCCTGGGGCAGG + Exonic
1129525005 15:76208261-76208283 GCAGAGGAGCAGCCAGAGGGAGG + Intronic
1129930249 15:79404601-79404623 ACAAAGGAAAGGCCTGAGGAAGG - Intronic
1130018096 15:80202672-80202694 ACAGAGGAATAGACTGAGGAGGG + Intergenic
1130342639 15:83012255-83012277 ACAGAGGAAAAGCCAGAGACAGG + Intergenic
1130556792 15:84928427-84928449 ACTGAGGAACTGACTGGGGAAGG - Intronic
1130903980 15:88227205-88227227 ACAAAGGAAGAGCCAGTGGATGG - Intronic
1131046980 15:89322639-89322661 ACAGAGGGCCAGCCTGACTATGG - Intronic
1131163679 15:90126961-90126983 AGAGAGCAGCAGCCTTAGGAAGG + Intergenic
1131450256 15:92533375-92533397 CCAGAGGAACTGCCTGAGGCTGG - Intergenic
1132096269 15:98987454-98987476 ACAGAAGTAAAGCCTGAGGTGGG + Intronic
1132197318 15:99925471-99925493 ACAGAAGAAAAGGCTGAGGATGG - Intergenic
1132198147 15:99929280-99929302 ACAGAAGAAAAGGCTGAGGATGG + Intergenic
1132626047 16:892108-892130 GCAGAGGCACCGCGTGAGGACGG + Intronic
1132645976 16:999476-999498 ACGGAGGAACAGCCTGGGGATGG - Intergenic
1133926935 16:10200862-10200884 ACTGAGGAGCAGCCAGAGGAGGG + Intergenic
1134024049 16:10941463-10941485 ACGGAGGAGAAGCCTGAGGGAGG + Intronic
1134105585 16:11483969-11483991 ACAGAGGAGAAGCAGGAGGAAGG + Intronic
1135965795 16:27033970-27033992 ACAGAGAAACAGCCTGTAGAGGG + Intergenic
1135983291 16:27165403-27165425 TCTCAGGAACAGCGTGAGGAGGG - Intergenic
1136726318 16:32360370-32360392 AGAGAGCAAGACCCTGAGGAAGG + Intergenic
1137977285 16:53042398-53042420 ACAGAGGAAGAGAGGGAGGAGGG - Intergenic
1138292203 16:55857210-55857232 ACAGATGAGGAGCCTGAGGCAGG - Intronic
1138633797 16:58320400-58320422 AGAGAGGAAAAGCAAGAGGAGGG + Intronic
1138812842 16:60171109-60171131 ACAGAGGAATAGCATGTGCAAGG + Intergenic
1139346694 16:66308297-66308319 GCACTGGAACAGCCTGGGGATGG - Intergenic
1139432253 16:66917546-66917568 AAAGAGAAACAGCAAGAGGAAGG + Intronic
1139976356 16:70814325-70814347 ATAGAGGAAAAGCAGGAGGAAGG + Intronic
1139976625 16:70817426-70817448 ACAAATGACCAGCCTGAAGAAGG + Intronic
1140151780 16:72374832-72374854 ACAGAGAAAAGGCCTAAGGATGG + Intergenic
1140208081 16:72949659-72949681 ACAGAGGAAGAGGGGGAGGATGG + Intronic
1140552937 16:75887167-75887189 AAGGAGCAACAGCCTAAGGAAGG + Intergenic
1141794363 16:86260164-86260186 ACAGAAGAAGAACCTGAGGATGG + Intergenic
1141943627 16:87295406-87295428 AAAGAGGAGGAGCCTGATGAAGG + Intronic
1203000115 16_KI270728v1_random:157387-157409 AGAGAGCAAGACCCTGAGGAAGG - Intergenic
1203131715 16_KI270728v1_random:1693788-1693810 AGAGAGCAAGACCCTGAGGAAGG - Intergenic
1142540573 17:655569-655591 ACAGAGCCACAGCCTGAAGATGG + Intronic
1142576655 17:913497-913519 AGAGAGCAACAGGCTGAGAAAGG + Intronic
1143559446 17:7683999-7684021 ACAGAGGAACAGACTGGGCGCGG - Intronic
1143564539 17:7713620-7713642 ACAGAGGAACAGCAAGTGCACGG + Intergenic
1143902630 17:10185508-10185530 ACAGATGAACAGCCAGAGGAAGG - Intronic
1143963451 17:10739084-10739106 ACAGAGGAACGGAGAGAGGAAGG - Intergenic
1144392885 17:14812557-14812579 TGAGCGAAACAGCCTGAGGACGG - Intergenic
1146061256 17:29608658-29608680 ACAGAAGAGCAACCTGAGGTCGG - Intronic
1147910274 17:43852056-43852078 ACAGAGGAACAGCATGTCCAAGG + Intronic
1148571910 17:48677167-48677189 ACAGAGGAAGACCCTGAAGAAGG - Intergenic
1148945830 17:51260803-51260825 GCAGCGGAACCGCCTGAGGCTGG + Exonic
1149979351 17:61297273-61297295 ACAGAGGAAGAGGCTGGGGATGG + Intronic
1151059746 17:71078350-71078372 ACAGAAGTAAAGCCTGAGGCTGG + Intergenic
1151063405 17:71123115-71123137 ACAGAGCAAAAGGCAGAGGAAGG - Intergenic
1151355833 17:73558015-73558037 ATAGAGCAACAGGGTGAGGAGGG - Intronic
1151522567 17:74640879-74640901 ACAGAGGAGGAGCCTGCAGAAGG + Intergenic
1151571211 17:74926457-74926479 ACAGAGGAAGAGGATGAGCAGGG + Intronic
1151851243 17:76691319-76691341 ACAGATGAACAGCCAGATGGAGG - Intronic
1152077596 17:78168878-78168900 ACAGCGGGACAGACTGTGGAGGG - Intronic
1152312098 17:79557691-79557713 ACACAGGCACAGGCTGAGGGAGG + Intergenic
1152508761 17:80771312-80771334 GCAGAGGGAGAGCGTGAGGAAGG - Intronic
1152563014 17:81087973-81087995 TCACAGAAACAGCTTGAGGACGG - Intronic
1154000260 18:10476717-10476739 TCAGATGCACAGCCTGGGGAAGG - Intronic
1154323136 18:13370391-13370413 CGAGGGGAACAGGCTGAGGATGG + Intronic
1155706712 18:28824362-28824384 ACAGAGGAACAGACTCAGGATGG - Intergenic
1156486267 18:37467561-37467583 ACAGGGGAGCAGGCAGAGGAGGG + Intronic
1156645924 18:39162289-39162311 ACCAATAAACAGCCTGAGGAAGG + Intergenic
1160005913 18:75069062-75069084 GCAGAGAAACAGGCCGAGGATGG + Intergenic
1160521128 18:79508758-79508780 ACAGAGAAACAGAGCGAGGAAGG - Intronic
1161022475 19:2016495-2016517 ACAGAGACATAGCCTGAGGCCGG + Intronic
1161380381 19:3961741-3961763 ACAGAGGAACAGCCTCAGACTGG + Intronic
1161723276 19:5915169-5915191 GCCGAGGAACTGCCTGGGGAGGG - Intronic
1163715635 19:18870591-18870613 ACTGAGGAACGGCCTGGTGAAGG - Exonic
1163752001 19:19083712-19083734 GCAGAGGTACAGCCTGGGCAAGG + Intronic
1164582999 19:29446529-29446551 ACAGAGCCACTGCCTGGGGAGGG - Intergenic
1165363881 19:35352237-35352259 GCAGAGCAGCAGCGTGAGGAGGG - Exonic
1165708330 19:37991939-37991961 AAAAATGAAGAGCCTGAGGAAGG - Intronic
1166139783 19:40799648-40799670 ACAGAGGAAAGGACGGAGGAGGG - Exonic
1166209945 19:41300032-41300054 ACAGAGGAGCAGGCTGAGGCTGG + Intronic
1167419820 19:49396195-49396217 GGAGGGGAACAGCCTGAGCAAGG - Intronic
1167428074 19:49439849-49439871 ACAGAGGCAGAGACTGAGGGAGG + Intronic
1168191690 19:54742924-54742946 ACAGAGAATGAGCCAGAGGAAGG + Intronic
1168193964 19:54759556-54759578 ACAGAGAATGAGCCAGAGGAAGG + Intronic
1168196009 19:54774281-54774303 ACAGAGAATGAGCCAGAGGAAGG + Intronic
1168197906 19:54789144-54789166 ACAGAGAATGAGCCAGAGGAAGG + Intronic
1168204374 19:54838527-54838549 ACAGAGAAAGAGCCAGAGGAAGG + Intronic
1168206600 19:54854700-54854722 ACAGAGAATGAGCCAGAGGAAGG + Intronic
1168338342 19:55609633-55609655 ACTGAGGAGCAGCATGGGGAAGG - Intronic
925034941 2:677607-677629 ACAGAGGAGCAGGCGGAGGCGGG + Intergenic
925837178 2:7957564-7957586 AGAGAGGAAGGGCATGAGGAGGG + Intergenic
925959333 2:9001168-9001190 ACTGTGGAACAGCCTGAGGCAGG - Intronic
927250563 2:20991901-20991923 CCAGAGAAACAGGGTGAGGAAGG + Intergenic
927515141 2:23667876-23667898 AAAGAGGAACAGAGGGAGGACGG - Intronic
928397216 2:30951938-30951960 AGGGGTGAACAGCCTGAGGAGGG + Intronic
929287163 2:40148553-40148575 AAAGAGGAACAGGCAGATGAGGG - Intronic
929473471 2:42220515-42220537 ACAGAGGAACAGCCAGTGTGTGG - Intronic
930154866 2:48095819-48095841 ACAGAGGAACAGGATGATAATGG + Intergenic
930978431 2:57492904-57492926 ATAGAGGAATAGTGTGAGGAAGG - Intergenic
931444989 2:62319522-62319544 GTAGATGAAAAGCCTGAGGAAGG - Intergenic
931917732 2:66977393-66977415 CCAGAGGCAGAGTCTGAGGAAGG - Intergenic
932336975 2:70937231-70937253 ACAGAGGAACAGAGGGAGGTGGG - Intronic
933281889 2:80341000-80341022 ACAAATGAACAGCCAGATGAAGG + Intronic
933853628 2:86392681-86392703 ACAGTGGAATGGCCTGTGGAGGG - Intergenic
934319650 2:91960746-91960768 AGAGAGCAAGACCCTGAGGAAGG - Intergenic
934619654 2:95796479-95796501 CCAGCTGAACAGCCTGGGGAGGG - Intergenic
934641234 2:96028078-96028100 CCAGCTGAACAGCCTGGGGAGGG + Exonic
935705676 2:105855234-105855256 GCGGAAGAACAGCCTGAAGAAGG + Exonic
935875406 2:107501150-107501172 ACAGATGAAGCACCTGAGGAGGG - Intergenic
937065034 2:119011453-119011475 ACTGAGGAACAGCCTGGGGAAGG + Intergenic
937680720 2:124641260-124641282 ACAGAGGAGGAGACTGAGGCTGG + Intronic
937692687 2:124773557-124773579 TCAGATGAACAGCCTGTGGCAGG - Intronic
938374442 2:130796528-130796550 ACAGAGGAGAAGGCTGTGGAAGG - Intergenic
938402540 2:131005258-131005280 ACACAGCAGCAGCCTGAAGAGGG + Intronic
941624917 2:167820859-167820881 ACATCAGAACAGCCTGAGGCAGG - Intergenic
941878317 2:170457678-170457700 ACCGTGGAACAGCCTCAGGCAGG - Intronic
942686458 2:178537701-178537723 ACAGAGGAACAGGAAGATGAAGG - Exonic
942833187 2:180261476-180261498 AGAGAGGAACAGCCTGTTGGTGG + Intergenic
942934999 2:181544386-181544408 TCTGAAGAACAGCCTGAGTATGG + Intronic
943217311 2:185055028-185055050 ACTGTAGAACAGCCTGAGGTAGG + Intergenic
947353403 2:229269934-229269956 ACAGAGGAACAACCCGCAGAGGG - Intronic
947715995 2:232339086-232339108 GCAGTGGCCCAGCCTGAGGAAGG + Intronic
948679902 2:239626684-239626706 ACAGAAGAACACACTGGGGAGGG - Intergenic
948694823 2:239727896-239727918 ACAGGTGAGCAGCCTGAGGTGGG - Intergenic
948915846 2:241034739-241034761 ACAGAGGAGCAGCTTGGGGTGGG + Intronic
1169017327 20:2302527-2302549 ACAGAGCTAGGGCCTGAGGATGG - Intronic
1169077052 20:2767772-2767794 ACAGAGTGGCAGCCTCAGGAGGG + Intergenic
1169122102 20:3102888-3102910 ACAGTGGAACAGGCCCAGGAAGG - Intergenic
1169155571 20:3327078-3327100 AGAGATGACCAGACTGAGGAAGG + Intronic
1169203552 20:3727854-3727876 GGAGAAGAACAGGCTGAGGAAGG + Intergenic
1171061074 20:21960610-21960632 AGAGAGGAACAGGCTGGGCACGG - Intergenic
1171144109 20:22766760-22766782 CCACAGGAAAAGACTGAGGAAGG + Intergenic
1171492831 20:25533161-25533183 GCAGTGGAGCAGCCTGAAGATGG + Intronic
1171950980 20:31421752-31421774 ACAGAGGACCAGACAGAAGAAGG + Intergenic
1172872278 20:38143222-38143244 ACAGCAGAACAGGCAGAGGAGGG + Intronic
1172919935 20:38472932-38472954 ACTGACGGACCGCCTGAGGACGG + Exonic
1172961436 20:38803081-38803103 ACAGAGGAAAGACCAGAGGAAGG - Intergenic
1174087592 20:48020057-48020079 ACAGAGGGGCAGCCTGGCGAGGG + Intergenic
1174379631 20:50148348-50148370 ACAGATGAGCAGACTGAGGTGGG + Intronic
1174515919 20:51092406-51092428 ACAGAGGATCAGCCTGAAAGGGG - Intergenic
1174555775 20:51394416-51394438 CCAGAGGAGCAGCGTGAGGAAGG - Intronic
1174730343 20:52909908-52909930 ACAGAGGAACAGCCCCTGAAAGG - Intergenic
1174753633 20:53137037-53137059 ACACAGGGACAGGCAGAGGAGGG - Intronic
1174988674 20:55485182-55485204 CAAGAGGAACTGCCTGATGACGG + Intergenic
1175980019 20:62734012-62734034 ACAGATGAGGAGCCTGAGGCTGG + Intronic
1178396852 21:32250476-32250498 ACTGAGAAACAACCTGGGGATGG - Intergenic
1179388305 21:40963141-40963163 AAGGAGGAAGAGACTGAGGAAGG + Intergenic
1179520662 21:41942251-41942273 ACAGAGGGGCAGCATGAGGAGGG + Intronic
1179613477 21:42566907-42566929 GCATAGGAGCAGCCTGAGGTGGG - Intronic
1180251287 21:46591688-46591710 ACTGAGTAACAGGCTGAGGTTGG + Intergenic
1182212813 22:28690774-28690796 AGAGAGCAAGACCCTGAGGAAGG + Intronic
1182582125 22:31320445-31320467 ACTGAGGAACAGCCTCACCAGGG + Intergenic
1182760535 22:32719078-32719100 AACCAGGAAAAGCCTGAGGAAGG - Intronic
1182884596 22:33762634-33762656 ACAAACGGACAGCCTGGGGAGGG + Intronic
1183314305 22:37128568-37128590 TCAGAGGAAGACCCTGATGAGGG - Exonic
1183485562 22:38086110-38086132 ACTGAGGAACAGACTGAGTGAGG + Intronic
1183521852 22:38300229-38300251 ACAGAGAAGAAGCCTGAGGCAGG + Intronic
1183587134 22:38759347-38759369 GCTGAGGCACAGCCTGAGTAAGG - Intronic
1183832859 22:40428041-40428063 GCAGAGGAACAGTCAGAGGGAGG - Intronic
1184194278 22:42916383-42916405 ACAGAGCAACAACCTGGGGTGGG + Intronic
1184248876 22:43249175-43249197 CCAGAGGAACAGGCAGAGGGTGG + Intronic
1184262870 22:43329347-43329369 AACGAGGAGCACCCTGAGGAAGG + Intronic
1184368702 22:44068977-44068999 ACAGAGGGTCAGGCTGTGGAAGG - Intronic
1184467654 22:44678251-44678273 GCATAGGAACAGCAGGAGGAAGG - Intronic
1184484356 22:44767057-44767079 ACAGCAAACCAGCCTGAGGATGG - Intronic
1184653640 22:45930638-45930660 AGGCAGGAGCAGCCTGAGGAAGG - Intronic
1185286046 22:50000313-50000335 ACAGAGGCACAGCGCGTGGATGG - Intronic
1185330489 22:50250028-50250050 ACGGAGGAGCAGCCAGGGGAAGG + Intronic
949400164 3:3657337-3657359 ACTTAGGAATAGCCTCAGGATGG - Intergenic
949651217 3:6162155-6162177 CCAGAGGCACACCCTGTGGAAGG - Intergenic
950507635 3:13405244-13405266 ACAGAACAAAAGCCTGAGCAAGG + Intronic
950683069 3:14598529-14598551 GCAGAGAAACAGCATGAGTAAGG - Intergenic
951053353 3:18119425-18119447 AAAGAAGGACAGCCTGAGAAGGG + Intronic
951234505 3:20218692-20218714 CCAGAAGAATAGCCTGAGCATGG - Intergenic
952388574 3:32860681-32860703 ACAGGGGAGTAACCTGAGGAAGG - Intronic
952504120 3:33992175-33992197 AAAGAGGAACAACATCAGGAGGG - Intergenic
953136141 3:40183294-40183316 CCTGAGGGACATCCTGAGGAAGG + Intronic
953572963 3:44087101-44087123 ACAGATGGACAGCCAGATGAAGG + Intergenic
954647476 3:52140425-52140447 CCAGAGGAACAGCCGGTGGCAGG + Intronic
958927418 3:100173890-100173912 ACAAAGAAACAGGCTGAGAAGGG - Intronic
960035627 3:113100049-113100071 GCAGAAGAAAAGCCTGAGGTTGG - Intergenic
960120362 3:113942815-113942837 AAAGAGGAAGAGCCAAAGGAAGG - Intronic
960966557 3:123109067-123109089 ACAGAAGAACAACCTTAGGAAGG - Intronic
961040331 3:123673878-123673900 TCAGAGGAGCAGCCTGAGTAGGG - Intronic
961197560 3:125015498-125015520 GCAAAGAAACAGCCTGAGGTGGG + Intronic
961238109 3:125386140-125386162 ACAGATGAACAGCCAGATGAAGG + Intergenic
962444304 3:135451102-135451124 ACCAAGGAACAGCTTCAGGATGG + Intergenic
962702301 3:138011564-138011586 AAAGAGAACCAGACTGAGGAGGG + Intronic
963006355 3:140729457-140729479 AGAGAAGAACAACCTGGGGAGGG - Intergenic
964311797 3:155401903-155401925 ACAGATAAACAGCCAGATGAAGG + Intronic
964434262 3:156635486-156635508 ACAAAGGCAGAGCCAGAGGAAGG - Intergenic
964596964 3:158443933-158443955 ACAGAGGAACAGCCAGTTGGTGG + Intronic
964637134 3:158870373-158870395 TAAGAATAACAGCCTGAGGATGG - Intergenic
964741900 3:159975199-159975221 ACAGATGAACAGCCAGGTGAAGG - Intergenic
964850207 3:161087957-161087979 ACAGATGAACAACATGAGGAAGG + Intronic
964948837 3:162261925-162261947 ACAGAGAAACCGTCTGTGGAAGG + Intergenic
965244350 3:166248436-166248458 ACAGGGTAACAGGCAGAGGATGG + Intergenic
965555495 3:170014100-170014122 ACTGTGGAACAGCCTCAGGCAGG + Intergenic
966270662 3:178101011-178101033 ACAGATTAACAGCTGGAGGAGGG - Intergenic
966413448 3:179666198-179666220 GCAAGGGAACAGCATGAGGATGG + Intronic
967319134 3:188178279-188178301 AAAGAGGAGAAGCATGAGGAGGG - Intronic
968727300 4:2253720-2253742 ACAGAGGAGGAGCCTGAAGAAGG + Intronic
969216866 4:5730131-5730153 ACAGATAAACAGACTGAGGCAGG - Intronic
969316168 4:6382529-6382551 GCAGAGGATGAGGCTGAGGAGGG - Intronic
970661242 4:18288091-18288113 ACTGGGGAGCAGCCTGTGGATGG + Intergenic
971451474 4:26805475-26805497 CAAGAGGCACGGCCTGAGGAAGG - Intergenic
973324553 4:48845474-48845496 ACAGAGGAATCGCCTGAGGTAGG - Intronic
974765522 4:66339874-66339896 AATGATGAACAGCCTAAGGATGG + Intergenic
976494808 4:85715510-85715532 ACAGATGACGAACCTGAGGAAGG + Intronic
976661284 4:87543225-87543247 ACAGAGCAAGACCCTGAGGAAGG - Intergenic
978398830 4:108310331-108310353 TCAGAGGGACAGCTTGACGATGG + Intergenic
978587658 4:110291547-110291569 CCTGAGGAGCTGCCTGAGGAGGG + Intergenic
980940327 4:139268097-139268119 ACAGAGGGAGAGCCCGTGGAGGG + Intronic
981094331 4:140762736-140762758 ACAGAGCAAGATCCTGTGGAAGG - Intergenic
981911072 4:149982244-149982266 GCAGAGGAAGAGCCTGAGTTTGG - Intergenic
982505040 4:156206396-156206418 ACTGAGTAACAGGCAGAGGATGG - Intergenic
982668152 4:158291523-158291545 AGAGGGGAACAGCCTGGGGTGGG - Intergenic
982965688 4:161903846-161903868 TCAGAGGAACAGAGTAAGGATGG - Intronic
983124682 4:163936099-163936121 ACAGGGGAAGGGCCTGACGATGG + Intronic
983626296 4:169804939-169804961 ACAGATGAACAGCCAGATGGAGG - Intergenic
984539409 4:181019222-181019244 ACAGAGGAAAAGCCATATGAGGG - Intergenic
985091248 4:186364506-186364528 ACAGAGGAAAACTCTGAGCAGGG - Intergenic
985534188 5:454131-454153 CCAGAGCAACACCCTGAGGTCGG - Intronic
985756639 5:1723396-1723418 ACAGAGGAAGAGACAGAGGCAGG - Intergenic
985903452 5:2814625-2814647 ACAGGGAAGCTGCCTGAGGATGG - Intergenic
986095582 5:4550561-4550583 ACAGAGAAACAGTATTAGGAGGG + Intergenic
986575210 5:9205222-9205244 ACTGAGGAACAGTCTAAGGGGGG + Intronic
987748116 5:22004245-22004267 ACAGAAAAACAGCATGAGGAAGG - Intronic
987919946 5:24266792-24266814 ACAGGGGAACAGCCTGTTGGTGG - Intergenic
989406913 5:41071478-41071500 ACAGAGAAAAAGCCTGAGCCTGG - Intergenic
989497224 5:42123598-42123620 ACAGAAAAAAAGCCTGAGGTTGG - Intergenic
990896860 5:60708938-60708960 ACTGTGGAACTGCTTGAGGAGGG - Intergenic
991768288 5:70014031-70014053 ACAAAATAACAGCATGAGGAAGG - Intergenic
991847526 5:70889113-70889135 ACAAAATAACAGCATGAGGAAGG - Intergenic
992317154 5:75567812-75567834 ACAGAGGAACAGCCTGAGGAAGG + Intronic
992918304 5:81482573-81482595 GCAGAAGAAAAGCCTGAGGGCGG - Intronic
993531251 5:89027814-89027836 ACAGAGTAACAGGCAGAGGTTGG - Intergenic
994438407 5:99768517-99768539 TCAGAGTGACAGGCTGAGGAGGG - Intergenic
996318990 5:122192697-122192719 TCAGAGGAACAGCTGGAGCAGGG + Intergenic
996452108 5:123637069-123637091 TCTGAAGAACAGCCTGAGGGAGG + Intergenic
998427283 5:142039620-142039642 ACATAGGGCCAGGCTGAGGATGG - Intergenic
998790390 5:145760211-145760233 CCAGCAGAACACCCTGAGGAAGG + Exonic
999709790 5:154307870-154307892 ACACAGGTACACCCTGAGCAGGG + Intronic
999803988 5:155065052-155065074 ACAGAGGAAGAGAATGAGGCTGG + Intergenic
1001083458 5:168683759-168683781 TCAGAGGAAGAGGCAGAGGAAGG - Intronic
1001276994 5:170358346-170358368 AAAGAGGAACAGCCTGGGCCTGG - Intronic
1001396944 5:171424471-171424493 ACCGAGGCACAGAATGAGGAAGG + Intronic
1001652635 5:173327021-173327043 TCAGAGGAAGCGCCAGAGGAGGG + Intronic
1001976690 5:176006221-176006243 ACACAGGAAGAGCCAGAAGAGGG - Intronic
1002240734 5:177837560-177837582 ACACAGGAAGAGCCAGAAGAGGG + Intergenic
1002329755 5:178433329-178433351 ACAAATGAACAGCCAGATGAGGG + Intronic
1003433179 6:6059175-6059197 ACAGCAGAACAGCCTCAGCAAGG - Intergenic
1004318403 6:14612428-14612450 AGAGGGTAGCAGCCTGAGGAGGG + Intergenic
1004416934 6:15433276-15433298 GCAGATGAACAAGCTGAGGAAGG - Intronic
1004672436 6:17810312-17810334 GCCGAGGAACGGCCTGAGGAAGG - Intronic
1006606479 6:35260700-35260722 ACTGAGGTCCAGACTGAGGAGGG - Intronic
1007075702 6:39064904-39064926 ACAGGGGAGCTCCCTGAGGACGG + Intronic
1007607986 6:43130106-43130128 ATGGAGAAACGGCCTGAGGAAGG - Intronic
1007825212 6:44594989-44595011 ACAGAGGGACAGCCTAAGGAAGG + Intergenic
1012005321 6:93706948-93706970 ACAGTGTAACAGGCAGAGGATGG + Intergenic
1013071958 6:106737553-106737575 ACAGATGAACAGCCAGATGGAGG + Intergenic
1014014368 6:116513021-116513043 CCAGATGTACAGCCTTAGGAAGG + Intronic
1014075264 6:117228183-117228205 ACAGAGAAACAAAGTGAGGAGGG - Intergenic
1014113301 6:117645451-117645473 ACAGAGGACAAGCCAAAGGAGGG + Intergenic
1018709208 6:166485828-166485850 ACAGAGGGACAGCCTGGGCTGGG - Intronic
1018926912 6:168212891-168212913 ACCGAGGATCAGCCTGGGGCTGG + Intergenic
1019525979 7:1480754-1480776 ACAGAGACCCAGCCTGGGGAGGG - Intronic
1019525992 7:1480788-1480810 ACAGAGACCCAGCCTGGGGAGGG - Intronic
1023217934 7:37885412-37885434 ACCCAGTGACAGCCTGAGGATGG + Intronic
1024178085 7:46861494-46861516 ACAGAGGAGGAGCCAGAGGTTGG - Intergenic
1024781676 7:52857992-52858014 ACAGAGGCACAGGCTGGGAAGGG - Intergenic
1025687081 7:63727174-63727196 ACAGAGGATCAGCATAATGAGGG - Intergenic
1026668181 7:72362691-72362713 ACAGAGGAATATCCTGGGGGTGG - Intronic
1031910961 7:127516264-127516286 ATGAAGAAACAGCCTGAGGAAGG - Intergenic
1032019104 7:128396713-128396735 GCAGAGGAACAATGTGAGGATGG + Intronic
1033037119 7:137885264-137885286 ACCGAGGAACAGCCTCAGAGTGG + Intronic
1033606133 7:142929581-142929603 ACAGAGGGAGACCCTGATGATGG - Intronic
1034052490 7:147997923-147997945 ACAAAGGGTCAGTCTGAGGACGG + Intronic
1034949433 7:155287137-155287159 GCAGGGGGACAGCCAGAGGATGG - Intergenic
1034990186 7:155543058-155543080 ACAGAGGAACAGCCTCTCCAAGG + Intergenic
1035158013 7:156929973-156929995 AAAGCTGAACAGCCTGAGGATGG + Intergenic
1035254807 7:157619429-157619451 AGAGAGGAGCAGCCTGGGGGAGG - Intronic
1035354083 7:158266601-158266623 ACTGAGGAACAGCCTGACAGAGG + Intronic
1035466741 7:159084387-159084409 AGACAGGAACAGCGTGAGGCAGG + Intronic
1035928939 8:3760115-3760137 AAAGAGTAACAGGCTGAGAAAGG + Intronic
1037748179 8:21662847-21662869 AGGGAGGAACAGCCTGGGCAAGG - Intergenic
1037796436 8:21999262-21999284 AGAGAGGAGCAGCTTGATGAAGG - Exonic
1038023076 8:23566388-23566410 AGGGAGGAACACCCTGGGGAGGG - Intronic
1038850191 8:31268255-31268277 ACAAAGGGACAGCCAGATGAAGG + Intergenic
1041100939 8:54396056-54396078 ACAGAGGAAAAGGCTGTGGGGGG + Intergenic
1041108383 8:54463306-54463328 AAAGAGGAACAGGAGGAGGAAGG - Intergenic
1041195836 8:55400585-55400607 GCAGAGAGACAGCCTGAGCAAGG + Intronic
1041318311 8:56587380-56587402 CTTGAGGAACAGCCTGAAGATGG + Intergenic
1041369668 8:57145453-57145475 ACTATGGAACAGCCTGAGGCAGG + Intergenic
1042568592 8:70137747-70137769 ACAGAGGAAGAACCTCAGGCAGG - Intronic
1043028823 8:75105867-75105889 ACAGATGAATAGCCAGATGAAGG + Intergenic
1044587075 8:93877868-93877890 GGACAGGAGCAGCCTGAGGAGGG - Intronic
1047184752 8:122622803-122622825 AAAAAGGAACAGCATGAAGACGG - Intergenic
1047446893 8:124927746-124927768 CCAGAGGAGCAGCCTGAGAAGGG + Intergenic
1048076323 8:131075172-131075194 ACAGAGGAACAGCATGGGCATGG - Intergenic
1048601354 8:135922020-135922042 ACAGAGAAATAGGATGAGGAGGG + Intergenic
1048852393 8:138657596-138657618 ACACAGGACCAGCATGTGGATGG + Intronic
1049388245 8:142354986-142355008 ACAGAAACACAGCCTGAGGAAGG + Intronic
1049480488 8:142820192-142820214 ACAGAGGGACCACCTCAGGAGGG + Intergenic
1050437317 9:5624796-5624818 ACAGAGGAACTGCCAGTTGATGG + Intergenic
1053846613 9:42244436-42244458 ACATAGGAAGATCCTGGGGATGG - Intergenic
1055185105 9:73442029-73442051 CCAGAGGAACAGCTCGATGAAGG + Intergenic
1056405290 9:86268126-86268148 ACCGTGAAACAGCCTGAGGCAGG + Intronic
1056825677 9:89874838-89874860 ACAAAGGCCCAGCCTGAGGAAGG + Intergenic
1056834598 9:89944419-89944441 ACAAAGGAACAGCCTGTAGTTGG - Intergenic
1057139990 9:92720584-92720606 ACAGAAGAACAGCCTGCGCAAGG - Exonic
1057839019 9:98470110-98470132 ACAAAGGAACAGGCTGAGCATGG + Intronic
1057950888 9:99368388-99368410 TCAGAAGAACAGACTGAGGATGG + Intergenic
1058669119 9:107345822-107345844 ACAGATGAACATACTGAGGCTGG - Intergenic
1059067692 9:111102759-111102781 ACAGGGGAGCAGACTGGGGAGGG + Intergenic
1059772300 9:117438813-117438835 AAATAGGAACAGCATCAGGAAGG + Intergenic
1060051627 9:120382538-120382560 ACAGAGGAGCTGCCTGCGGCTGG + Intergenic
1060487805 9:124060453-124060475 ACAGAGGCAGAGCCAGAGGCTGG - Intergenic
1061485906 9:130920373-130920395 ACAGATGAGCAGCCTGTGAAGGG + Intronic
1061500010 9:130996794-130996816 CCAGGGGAGCAGCCTGATGATGG - Intergenic
1062327282 9:136018286-136018308 GCTGGGGAGCAGCCTGAGGAGGG + Intronic
1062695700 9:137875289-137875311 ACAGAGGAGCAGCCCGAGTGGGG - Intergenic
1185698173 X:2211651-2211673 ACAGAGGAATAGTGTGAGGCTGG + Intergenic
1187786583 X:22894955-22894977 AGAGAGAAAAAGGCTGAGGATGG - Intergenic
1188355705 X:29188152-29188174 ACAGAGGAGTAGTCTGTGGAAGG - Intronic
1189646244 X:43135795-43135817 ACAGAGGAACAGAGAAAGGAGGG - Intergenic
1189920224 X:45896339-45896361 ACAGATGAACAGCCAGTTGAAGG + Intergenic
1190342636 X:49309651-49309673 ACAAAAGAAAAGTCTGAGGAAGG + Intronic
1192556986 X:72098128-72098150 GCCAAGGAAGAGCCTGAGGAAGG - Intergenic
1194244929 X:91499740-91499762 ACAGATGATAAGGCTGAGGATGG + Intergenic
1195793286 X:108614436-108614458 ACAGAGGGACAGACAGAAGATGG + Intronic
1197441198 X:126493649-126493671 ACAGGGTAACAGCCAGAGGTTGG + Intergenic
1198082915 X:133255828-133255850 ACAGAGCAAAAGCAGGAGGAGGG - Intergenic
1198460891 X:136862145-136862167 ACAGAGAAACACCTAGAGGAGGG + Intronic
1199974505 X:152885079-152885101 CCAGAGGAAAAGGCAGAGGAAGG - Intergenic
1200563905 Y:4741050-4741072 ACAGATGATAAGGCTGAGGAAGG + Intergenic
1201738080 Y:17292369-17292391 ACAGGACAACAGCCTGAAGAAGG - Intergenic
1201890903 Y:18942811-18942833 ACAGAGGGAGAGAGTGAGGAGGG + Intergenic
1201940374 Y:19452340-19452362 ACAGAGGCACAGACTGCGGGAGG + Intergenic