ID: 992320796

View in Genome Browser
Species Human (GRCh38)
Location 5:75611645-75611667
Sequence CCGGGCGCGCCCGGGGCCAA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 124}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992320785_992320796 1 Left 992320785 5:75611621-75611643 CCGCGGAGGAGACTATGGACCCC 0: 1
1: 0
2: 0
3: 6
4: 76
Right 992320796 5:75611645-75611667 CCGGGCGCGCCCGGGGCCAAGGG 0: 1
1: 0
2: 2
3: 11
4: 124
992320781_992320796 15 Left 992320781 5:75611607-75611629 CCTGCGCTCAGGGCCCGCGGAGG 0: 1
1: 0
2: 1
3: 10
4: 180
Right 992320796 5:75611645-75611667 CCGGGCGCGCCCGGGGCCAAGGG 0: 1
1: 0
2: 2
3: 11
4: 124
992320784_992320796 2 Left 992320784 5:75611620-75611642 CCCGCGGAGGAGACTATGGACCC 0: 1
1: 0
2: 2
3: 5
4: 66
Right 992320796 5:75611645-75611667 CCGGGCGCGCCCGGGGCCAAGGG 0: 1
1: 0
2: 2
3: 11
4: 124
992320780_992320796 16 Left 992320780 5:75611606-75611628 CCCTGCGCTCAGGGCCCGCGGAG 0: 1
1: 0
2: 0
3: 3
4: 184
Right 992320796 5:75611645-75611667 CCGGGCGCGCCCGGGGCCAAGGG 0: 1
1: 0
2: 2
3: 11
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992320796 Original CRISPR CCGGGCGCGCCCGGGGCCAA GGG Exonic
900513465 1:3070724-3070746 CCGGGCGGGCCCCGAGCCGAGGG - Intronic
902067544 1:13700452-13700474 CCGGGCGTGCCGGGGGCCCCGGG + Intronic
902311513 1:15584926-15584948 CCGGGTGCGCCCGGGGCCCGGGG - Exonic
903115568 1:21176428-21176450 CCGGGCGCGCCGGGGTGCAGGGG + Intronic
912429091 1:109619819-109619841 CCAGGCGGGGGCGGGGCCAAGGG + Intronic
914373334 1:147050660-147050682 CCCGGCCCGCCCGGGGGCAGAGG - Intergenic
918326790 1:183417952-183417974 CCCGGCTCGCAGGGGGCCAAAGG - Intronic
920632892 1:207669656-207669678 CTCTGCGCGCCCGGGTCCAAAGG + Intronic
921671107 1:217925064-217925086 CCGAGCGCGCCCAGGGCCTGGGG - Intergenic
924754764 1:246931426-246931448 CCGGGCGTGCGCGGGGCCAACGG - Intronic
1064167784 10:13001572-13001594 CCGGGCCCTCCCGGGGCGCACGG + Exonic
1064552847 10:16520740-16520762 CCGGGCCCGCCCGGGGCGCCCGG - Exonic
1065727289 10:28677981-28678003 CCGGGGGCGCACGGGGCCCGGGG + Intronic
1069738433 10:70672589-70672611 CCTCGCGCGCCCGGAGCCAGCGG + Intergenic
1073290074 10:102409139-102409161 CCGGGCGGCCCGGGGGCCGAGGG - Intronic
1074522631 10:114239494-114239516 CCGGGCGCGGCTCGGGCCAGGGG - Exonic
1076639056 10:131901442-131901464 CCGGGCGGGGCAGGGGCCAGGGG + Intronic
1077464909 11:2729124-2729146 CTGGGCTCTCCCGGGGCCGAGGG + Intronic
1083800039 11:65041345-65041367 CCGAGCGCGCCCAGCGCGAAAGG + Exonic
1083822562 11:65181489-65181511 CCGGGCGGGCCCGGGGCTGCGGG + Exonic
1084153776 11:67303134-67303156 CACGGCGCGCCCTCGGCCAAGGG - Intergenic
1084690011 11:70719637-70719659 CCTGGCACGCCAGGGGCCCAGGG + Intronic
1085534783 11:77211385-77211407 CGGGGCACCCCAGGGGCCAAGGG + Intronic
1086455339 11:86955033-86955055 CCGGGGGCGCCCGGGGGCGTCGG - Exonic
1090211030 11:124921232-124921254 CCGGGCGAGCTCGGGGCCCTGGG + Exonic
1092462507 12:8698425-8698447 CCGAGCGCGCCCGGGGTCCGGGG + Intronic
1102854122 12:116278018-116278040 ACGGGCGCGCCCGGGACCCACGG - Intergenic
1106328629 13:28718573-28718595 TCGTGCGCGCCCGGGTTCAAGGG + Exonic
1112580633 13:100674379-100674401 CCGGGCGCACCCGGCGCCTGCGG - Intronic
1114525534 14:23365337-23365359 CGGGGCGCCCCCGCGGCCTAGGG - Exonic
1119182711 14:72615210-72615232 CAGGGCCCGCCCTGGGCCACGGG + Intergenic
1123004449 14:105314675-105314697 CCGGGCGCGCGCGGGGCGGCCGG + Exonic
1124995797 15:34721985-34722007 CCGGGCAGGACCGGAGCCAAAGG + Intergenic
1129334233 15:74842970-74842992 TCGGGCGGGCACGGGGCCATCGG + Intronic
1129780232 15:78264920-78264942 CCGGGCTCCCGAGGGGCCAAGGG + Intronic
1136585058 16:31179495-31179517 CTGGACGAGCCCGGGGCCCAGGG + Intergenic
1136620863 16:31427756-31427778 CCGGGGGCGTCCGGGGCCTCAGG + Exonic
1142285916 16:89171503-89171525 CGGGGCGGGGCCGGGGCCGAGGG - Intergenic
1142379037 16:89721478-89721500 CGGGGCGGGCCAGGGGCCAGGGG - Intronic
1142638287 17:1270978-1271000 CCGGCCGCGCGCGGGGACACCGG + Exonic
1143487156 17:7261440-7261462 CGGGGCGCGCCGAGGGCCGAAGG - Intronic
1146053292 17:29568624-29568646 GCGCGCGAGCCCAGGGCCAACGG + Exonic
1146062057 17:29612824-29612846 CCGCGGGCGCGCGGGGCCACGGG + Intronic
1147150449 17:38510889-38510911 CCGCCCGCGCCCGGGGACACGGG + Exonic
1147879762 17:43646108-43646130 CGGGGCGCGCCCGGGGAGCAGGG + Intronic
1152751771 17:82065644-82065666 CCCGGCGCCCTCGGAGCCAAAGG - Intronic
1160499730 18:79395794-79395816 CCGGGCCCGCGCGGGGCCCCGGG - Intergenic
1160500866 18:79400584-79400606 CCCGGCGCGCCCGGGACCGAGGG + Intronic
1160619332 18:80159943-80159965 GCGGGCGCGCCCGGGGTCTGGGG + Exonic
1161150107 19:2702872-2702894 CCGGGCGCGGGCGGGGCCGGGGG + Intergenic
1161215777 19:3094511-3094533 GCGGGCCGGCCCGGGGCCGAGGG + Exonic
1161777121 19:6269697-6269719 CCGGGAGCTCCAGGGGCCACGGG - Intronic
1162398401 19:10430941-10430963 CGGGGCGCGCGCGGGGCCAGGGG - Intronic
1163118324 19:15200941-15200963 CGGGACGCGCCCGGAGCCCAGGG - Exonic
1165080106 19:33302068-33302090 CCGGGCGCGCCCGCGGGCCCCGG - Exonic
1165851452 19:38852218-38852240 CCGCGCGCGGCCGGGGGCCAGGG - Intronic
1166785475 19:45364398-45364420 AGGGGGGCGCCAGGGGCCAAAGG - Intronic
1166878821 19:45914524-45914546 CTGGGGGCGCCAGGGGCCAACGG - Exonic
1167877848 19:52429101-52429123 CAGGCCGGGCCCGGGGCCGAGGG - Intergenic
1168307191 19:55442209-55442231 CCCGGTGCGCCCGGGGCGCACGG + Exonic
1168695410 19:58401255-58401277 CGGGGCCCGCCCGGGGCAAGAGG - Intergenic
1202657439 1_KI270708v1_random:36818-36840 CCGGGATCGCCCGAGGCCCACGG - Intergenic
928094018 2:28393106-28393128 CCTGGCGCGCTCGGGGCCGCGGG + Exonic
928964846 2:36966396-36966418 CCGGGCGCCGGCGGTGCCAAGGG - Exonic
941119093 2:161507804-161507826 CCGGGCGTGCGCGGGGCCAACGG - Intronic
941367047 2:164621625-164621647 CCCGGGGCGCTCGGGGCCACTGG + Exonic
942346254 2:175005440-175005462 CCGCGCGCGCCCGTTGCCATGGG - Intergenic
948644967 2:239398820-239398842 CCGGGGGAGCCCTGGGCTAAGGG - Intronic
1171819658 20:29823204-29823226 CTGCGCTTGCCCGGGGCCAAAGG - Intergenic
1172997836 20:39083888-39083910 CCAGGCCAGCCAGGGGCCAAGGG - Intergenic
1173594026 20:44247454-44247476 CCAGGCTCTCCCTGGGCCAATGG - Exonic
1175372325 20:58500423-58500445 CCGGCCCCGCTCTGGGCCAAGGG + Intronic
1176176661 20:63730261-63730283 CCGGGGGCGCCAGGGGCTACAGG - Intronic
1178513903 21:33230155-33230177 CCGGGCGCGGCTGGGGCCCGAGG + Exonic
1178922504 21:36747844-36747866 GCCGGCGCGCCCGGGGCCTCGGG - Exonic
1181299080 22:21867039-21867061 CGCGCTGCGCCCGGGGCCAAGGG + Intronic
1182279369 22:29209098-29209120 CCAAGCGGGCCCGGGGCCAAGGG - Intronic
1183689665 22:39381683-39381705 CCTGGCCCGCCTGGGGACAAAGG - Exonic
1183969907 22:41469064-41469086 CCGGGCACGCCCCTGCCCAAAGG + Intergenic
1185317575 22:50185724-50185746 CCCGGCGCTCCCGGGTCCTAAGG - Intergenic
959085833 3:101849797-101849819 CCGGGCGAGCCGGGCGCCGAGGG - Exonic
961081517 3:124032914-124032936 CCGGGCGAGCCCGGGGCTGCAGG - Intergenic
961665014 3:128489251-128489273 CCGGGCGCCCCCGGAGCCGAGGG - Intronic
963038430 3:141051580-141051602 CCCGGCGCGCCGGGGGCCAGCGG + Exonic
965590359 3:170356806-170356828 CCGGGCGAGGCCGGGGCCGCCGG + Intergenic
967055353 3:185825123-185825145 CCCGGCCCGCCCGGGGGCAGAGG + Intergenic
968729333 4:2262210-2262232 CCGGGCCGGGCTGGGGCCAATGG + Exonic
968835798 4:2963618-2963640 CCGGGCGGGCTCGGCGCTAACGG - Intronic
969240357 4:5893073-5893095 CCGGGCGCGACTGCGGCCCAGGG + Intergenic
970967872 4:21948843-21948865 CCGCGCGCCCCCGCCGCCAAGGG - Intergenic
972960556 4:44447943-44447965 CCGTGCGCTCCCGGGCCCGAGGG + Exonic
973293326 4:48490700-48490722 CCGGCCGGCCCCGGGGCCGAGGG + Exonic
973931067 4:55793688-55793710 CCGCGCCCGCCCGGGGCGAGGGG - Intergenic
981348318 4:143700262-143700284 CCGGGCGCGTCCGGGGCTGTGGG + Exonic
985068403 4:186144876-186144898 CCGGGCGCGCCCGGGGTCCGCGG - Exonic
985587876 5:750361-750383 CCGGGGTCGCCCGGAGCCACAGG - Intronic
985703300 5:1386478-1386500 CCACGCGCGCCCGGCGTCAACGG - Intergenic
990148398 5:52788359-52788381 CTGGGCGGGCGCGGGGCCGAGGG - Exonic
992105888 5:73448590-73448612 CCGGGCGCGAGCGGAGCCCAGGG - Intergenic
992320796 5:75611645-75611667 CCGGGCGCGCCCGGGGCCAAGGG + Exonic
993457260 5:88141302-88141324 GCGGGCGCGGCCGGGGAAAAGGG + Intergenic
994359981 5:98839636-98839658 CCCGGCGCCCCCGGAGCCAGCGG + Intergenic
997209156 5:132067503-132067525 CCGGGAGCACCCTGGGTCAAGGG - Intergenic
997266027 5:132496039-132496061 CCAGGGGCGCCCCGGGCGAACGG - Intergenic
999428328 5:151505825-151505847 CCAGGCGCTCCCGGGGACTAGGG + Exonic
1002140227 5:177133518-177133540 CCGCTCGCGGCCGGGGCCTACGG - Intronic
1002927280 6:1611682-1611704 CAGGGCGCGCCCGGGGGCGCGGG + Exonic
1010324521 6:74549755-74549777 CTGGGCCCACCCAGGGCCAAGGG - Intergenic
1016014243 6:139167209-139167231 CCGGGAGCGCCCGGTGGCACAGG - Exonic
1018769037 6:166956322-166956344 CCGGGTGCGCCCGGAGCCCTGGG + Exonic
1019395667 7:816574-816596 CGGGCCGCGCCCCGGGCCGAGGG - Intergenic
1020274482 7:6615974-6615996 CCGAGGTCGCCCTGGGCCAAGGG - Exonic
1025992501 7:66506322-66506344 GCGGGCCGGCCGGGGGCCAAGGG - Intergenic
1026665237 7:72336095-72336117 CCGGGGGCGCCAGGGTGCAAGGG - Intronic
1029459914 7:100688573-100688595 CCAGGTGAGCCCCGGGCCAAGGG - Exonic
1031629677 7:124032311-124032333 CCCGGCGCCCCTGGGGCCACGGG + Exonic
1034197944 7:149262365-149262387 CCGGGCGTCCGCGGGGCCGAGGG - Intronic
1034218013 7:149422566-149422588 CAGGGCGCGCCGGCGGCCCACGG - Intergenic
1035021893 7:155805204-155805226 CAGGGGGCGCCCTGGGCCCAGGG + Intronic
1035212265 7:157337178-157337200 CCGGGCGCGCGCGGGGCCCTAGG - Intronic
1036665427 8:10734178-10734200 CCAGGCGCGTCCCGGGCCCACGG + Intronic
1037876577 8:22551685-22551707 CGGGGCGCGCGCGGGGACACTGG - Exonic
1038760936 8:30384215-30384237 CCGGGGCCCCCGGGGGCCAAGGG + Intergenic
1039467994 8:37797353-37797375 CCGGGCGCGCCCCGAGCCTCGGG - Exonic
1046654108 8:116874406-116874428 GAGGGCGGGCCCGGGGCGAAGGG + Intronic
1049761435 8:144333682-144333704 CGAGGCGCGCGCGGGGCCAGGGG - Exonic
1055454421 9:76459402-76459424 CCCAGCCCGCCCGGGGCCACGGG - Intronic
1059305414 9:113349814-113349836 CCAGGCGCGCCCGGGGTCTCCGG - Intronic
1059406087 9:114098838-114098860 CCGGGGGAGCGCGGGGCCTAGGG + Intronic
1059839164 9:118192410-118192432 CAGGACCCGCCCTGGGCCAAGGG + Intergenic
1060952265 9:127612017-127612039 CCGCGCGCGCCCGGGGCGCAGGG - Intergenic
1061242715 9:129383672-129383694 CCGGGCGCGCCCGGGTGCGCAGG - Intergenic
1061961770 9:133992348-133992370 CCGCGCGCGCGCGGGGCTCAGGG + Intronic
1062325041 9:136008841-136008863 CCTGGCCCGCCCGGGGCGCAGGG + Exonic
1185792524 X:2938183-2938205 CCGGGAGCACCCCGGGCCAGCGG + Exonic
1188004170 X:25005826-25005848 CCGGAGCCGCCCGGGGCCACCGG + Intronic
1192467361 X:71366694-71366716 CGAGGCGAGCCCGGGGCCAGGGG + Intronic
1200147620 X:153934792-153934814 CCGGGCTCGGCCGGGGCCCTCGG + Intronic