ID: 992321073

View in Genome Browser
Species Human (GRCh38)
Location 5:75613480-75613502
Sequence CTGCATATATAAATGAAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 261}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992321062_992321073 29 Left 992321062 5:75613428-75613450 CCAGAGCCCAAGTGTAGAGGTTG 0: 1
1: 0
2: 2
3: 18
4: 147
Right 992321073 5:75613480-75613502 CTGCATATATAAATGAAGGTAGG 0: 1
1: 0
2: 2
3: 16
4: 261
992321070_992321073 0 Left 992321070 5:75613457-75613479 CCTAGGTACAGGGATGCTTCATC 0: 1
1: 0
2: 1
3: 8
4: 130
Right 992321073 5:75613480-75613502 CTGCATATATAAATGAAGGTAGG 0: 1
1: 0
2: 2
3: 16
4: 261
992321065_992321073 22 Left 992321065 5:75613435-75613457 CCAAGTGTAGAGGTTGGCCTTTC 0: 1
1: 0
2: 0
3: 10
4: 106
Right 992321073 5:75613480-75613502 CTGCATATATAAATGAAGGTAGG 0: 1
1: 0
2: 2
3: 16
4: 261
992321069_992321073 5 Left 992321069 5:75613452-75613474 CCTTTCCTAGGTACAGGGATGCT 0: 1
1: 0
2: 1
3: 8
4: 135
Right 992321073 5:75613480-75613502 CTGCATATATAAATGAAGGTAGG 0: 1
1: 0
2: 2
3: 16
4: 261
992321064_992321073 23 Left 992321064 5:75613434-75613456 CCCAAGTGTAGAGGTTGGCCTTT 0: 1
1: 0
2: 2
3: 12
4: 94
Right 992321073 5:75613480-75613502 CTGCATATATAAATGAAGGTAGG 0: 1
1: 0
2: 2
3: 16
4: 261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992321073 Original CRISPR CTGCATATATAAATGAAGGT AGG Intronic
902605414 1:17566398-17566420 CTGTAACTATAAATCAAGGTGGG + Intronic
903185760 1:21628112-21628134 CTGAATGAATGAATGAAGGTTGG + Intronic
904973914 1:34441508-34441530 CTGAATATGAAAATGAAGGAGGG - Intergenic
905378118 1:37538872-37538894 CTGAAAATATAGATGAAGTTTGG - Intronic
906267565 1:44444739-44444761 ATGGATATAGAAATCAAGGTAGG - Intronic
909205303 1:72749012-72749034 CTGCAGATAGTAATGAAGATAGG - Intergenic
909589774 1:77334213-77334235 CTGGATATAAAAATGTAGGTTGG + Intronic
911140884 1:94501341-94501363 CTGCATATATAACTGGAGCATGG + Intronic
911447347 1:98014097-98014119 CTGAATATTTAAATGAGGATGGG + Intergenic
913039681 1:115010333-115010355 CTGCTTATATAAATTAAGTAAGG - Intergenic
915142745 1:153777236-153777258 CTGGATGAATTAATGAAGGTGGG - Intronic
917068648 1:171125183-171125205 ATAAATATATACATGAAGGTGGG - Intergenic
918652450 1:186982597-186982619 CTGAATGAACAAATGAAGGTAGG + Intronic
919214924 1:194540947-194540969 CTGCTTTTATAAATGAAGTAAGG - Intergenic
921574810 1:216822194-216822216 CTGCATATTTACATGTAGGCTGG - Intronic
921586532 1:216952987-216953009 CTGCATATGTATATGTATGTGGG + Intronic
923448243 1:234092559-234092581 CTGCGAATAAAAATGAATGTAGG + Intronic
923965457 1:239133786-239133808 CTACATATATAAATGAGAGTTGG + Intergenic
924600657 1:245485864-245485886 ATGAATAAATAAATGAAGGAAGG + Intronic
1063048890 10:2423758-2423780 CTGCATATATGACTGAACATCGG - Intergenic
1064800778 10:19068565-19068587 CTGCATAACTAATTGAAGGCTGG + Intronic
1064955790 10:20907991-20908013 CTCCATATAAAAATGATGGGAGG + Intronic
1065567259 10:27025679-27025701 CTGCATTTAGAAATGAAGTGAGG - Intronic
1066077890 10:31898548-31898570 CTGCATATAAAAATGCAGTTGGG - Intronic
1066284010 10:33946310-33946332 CTGAATATGTAAAAGAAGGAAGG + Intergenic
1067049465 10:43004192-43004214 CTGAATAAATAAATCAATGTGGG - Intergenic
1067517684 10:46967014-46967036 TTTCATATATAAATGAAATTAGG - Intronic
1067644565 10:48084815-48084837 TTTCATATATAAATGAAATTAGG + Intergenic
1068397956 10:56488174-56488196 CTGTTTATATAAATAAAAGTTGG + Intergenic
1069644594 10:69984205-69984227 CTGAATATACAAATCAAGTTAGG - Intergenic
1072589367 10:96813426-96813448 CTTCTTCTATAAAAGAAGGTTGG - Intergenic
1072773779 10:98168151-98168173 CTGCATATGTAACTGGCGGTAGG - Intronic
1074215164 10:111377088-111377110 CTGCATCTGGAAATGAAGGAAGG + Intergenic
1074515656 10:114166674-114166696 GTGGCTATACAAATGAAGGTGGG + Intronic
1074617375 10:115082961-115082983 CTGCATGTTTAAAAGAAGATCGG + Intergenic
1075137953 10:119803212-119803234 ATGCTTCTATAAATGTAGGTTGG - Intronic
1077778370 11:5296453-5296475 TTTAAAATATAAATGAAGGTAGG - Intronic
1077901205 11:6490472-6490494 GTGAATATATAGATGAATGTGGG - Intronic
1077951898 11:6968352-6968374 CTGAATATATAAATTACGTTGGG + Intronic
1079631277 11:22679416-22679438 ATGCATATATAAATAAATCTTGG + Intronic
1080533824 11:33202285-33202307 CTGAATCTATAAATGAGGTTGGG + Intergenic
1081839761 11:46190584-46190606 CTGAATCTATAAATCAAGTTGGG - Intergenic
1083336632 11:61925646-61925668 ATCCATATAGAAATGAAGGATGG + Intergenic
1085928222 11:81047993-81048015 GTGTATATATATATGAAGTTTGG - Intergenic
1085928227 11:81048220-81048242 GTGTATATATATATGAAGATTGG - Intergenic
1085928230 11:81048349-81048371 ATTCATATATATATGAAGATTGG - Intergenic
1085928231 11:81048384-81048406 GTGTATATATATATGAAGATTGG - Intergenic
1085928232 11:81048429-81048451 GTGTATATATATATGAAGATTGG - Intergenic
1085928240 11:81048724-81048746 ATTCATATATATATGAAGATTGG - Intergenic
1085928241 11:81048759-81048781 ATTCATATATATATGAAGATTGG - Intergenic
1086365362 11:86104488-86104510 CAGCATATTAAAATGAAGCTAGG + Intergenic
1087623607 11:100570220-100570242 ATGAATTTATAAATGAAGCTTGG - Intergenic
1088229996 11:107663849-107663871 CTGCATGCATAAATGAAAATGGG - Intronic
1088668422 11:112117825-112117847 ATGTATATATATATAAAGGTCGG - Intronic
1088763685 11:112956545-112956567 CTGCATAAATATATGATGGGTGG + Intergenic
1089336438 11:117727113-117727135 CCACATTTATAAATGAAGGATGG + Intronic
1090361280 11:126174695-126174717 TTGAATATATAAATGAAAGATGG - Intergenic
1090661584 11:128886061-128886083 ATGCATGTCTAACTGAAGGTTGG - Intergenic
1090983202 11:131741676-131741698 ATGAATATATAAATAAAGGATGG + Intronic
1092149634 12:6238642-6238664 CTTCTCATATAAATGCAGGTGGG - Intergenic
1093727717 12:22533882-22533904 CTACATACATGAATGAAGTTGGG + Intronic
1097721349 12:63025008-63025030 CTTCTTCTTTAAATGAAGGTTGG - Intergenic
1098982165 12:76968328-76968350 CTGAATATATAAATGAATGTAGG + Intergenic
1099040737 12:77651444-77651466 CTGCTTATATGAATGATGATTGG + Intergenic
1100308555 12:93373408-93373430 CTGCATATAAACATGATGCTTGG + Intergenic
1101248101 12:102904026-102904048 ATGCATAAATAATTGAAAGTTGG + Intronic
1102072195 12:110029846-110029868 TTGCAAATAGAAATGATGGTTGG - Intronic
1103219821 12:119234435-119234457 GTGCATATAGAAATGATGTTGGG - Intergenic
1103442601 12:120974447-120974469 ATAAATATATAAATGAAGCTGGG + Intergenic
1105267028 13:18829730-18829752 CTGCATTTAGAAATGAAGCGGGG - Intergenic
1107934353 13:45332483-45332505 ATGCATACATAAATGAATGGAGG + Intergenic
1108556260 13:51595820-51595842 GTAAATATATAAATAAAGGTGGG + Intronic
1108780962 13:53832609-53832631 ATACATTTATAAATAAAGGTAGG - Intergenic
1109066647 13:57702567-57702589 CTGCAAATATAAATGATGTCTGG - Intronic
1110044002 13:70805728-70805750 CTGGATATAAAAATCTAGGTTGG + Intergenic
1110049004 13:70871067-70871089 CAGCAAATATAAATGATGGATGG + Intergenic
1110109877 13:71732671-71732693 CTGTATTTACAAATAAAGGTAGG - Intronic
1110560380 13:76905325-76905347 TTGCCTATATAAAAGAAGCTTGG + Intergenic
1111578737 13:90194797-90194819 CTGGATATAGAAATTCAGGTTGG + Intergenic
1112169284 13:96953037-96953059 CTACCCATATAAATGATGGTAGG + Intergenic
1113155950 13:107322144-107322166 GAGCATATACAAAAGAAGGTTGG - Intronic
1117162818 14:53005949-53005971 CTGAGTAAATAAATGAAGGCTGG - Intergenic
1117765374 14:59076319-59076341 CTCCATATATAGATGCAGATGGG - Intergenic
1118115673 14:62773964-62773986 CTCCATATATAAAGGTTGGTAGG - Intronic
1122223915 14:100261565-100261587 CTGCATATGGACATGGAGGTTGG - Intronic
1122334701 14:100963875-100963897 GTGAATAAATAAATGAAAGTTGG + Intergenic
1124968044 15:34453922-34453944 CTGAATTTATAAATGAATTTTGG + Intergenic
1125277590 15:38009781-38009803 CTGTATATATAAATGAGGCATGG + Intergenic
1127747697 15:61997431-61997453 CTGGATATAGAAATGTAGGAAGG - Intronic
1131661978 15:94526946-94526968 CTGCATATTTACATGATGTTGGG + Intergenic
1138417761 16:56880944-56880966 GTGCATATATGAATGCATGTAGG - Intronic
1139074468 16:63427268-63427290 GTGAATAAATAAATGAAGGGAGG + Intergenic
1143530002 17:7497218-7497240 CTGAATCTATAAATGATAGTGGG + Intronic
1143869268 17:9946574-9946596 CTGCCTCAATAAATGAACGTGGG - Intronic
1144090631 17:11852868-11852890 GTGTATATATAAAAGAAAGTAGG + Intronic
1148875698 17:50685848-50685870 CTGAATATAAAAATGAAAATAGG - Intronic
1149499689 17:57142831-57142853 TTGAATAAATAAATGAAGCTGGG - Intergenic
1151043334 17:70890180-70890202 CTACATCTTTAAATCAAGGTGGG - Intergenic
1151167264 17:72215969-72215991 CTCCATTTATAACTGAAGGTTGG - Intergenic
1152090228 17:78242369-78242391 CTGCATTTATAAATGCTGGTTGG - Intergenic
1154421384 18:14231704-14231726 CTGCATTTAGAAATGAAGTGGGG + Intergenic
1155194118 18:23456868-23456890 TAGCAGATATAAGTGAAGGTGGG + Intronic
1156625698 18:38905421-38905443 GTGCATATATAAAAGAATGAAGG - Intergenic
1156990509 18:43402314-43402336 CTGCTTATATAAATTAAGTAGGG + Intergenic
1157070889 18:44406793-44406815 CTGGATATAGAAATCATGGTTGG - Intergenic
1157337624 18:46753183-46753205 ATGAATAAATAATTGAAGGTAGG - Intronic
1157782678 18:50454111-50454133 CTGCCTTGATGAATGAAGGTGGG + Intergenic
1158541328 18:58357544-58357566 CTTCATATAAAAAGGAAGGGAGG - Intronic
1160065971 18:75574648-75574670 TTTCATAGATAACTGAAGGTAGG - Intergenic
1161418923 19:4164706-4164728 CTAAATAAATAAATAAAGGTGGG - Intronic
1164410789 19:28003172-28003194 CTGCCTACAGAAATGAAGCTTGG + Intergenic
1164568151 19:29345807-29345829 CTGAAATTATAAATGAAAGTAGG + Intergenic
1166073788 19:40402043-40402065 CTGCATTTTTAAATGGGGGTGGG - Intronic
1168267272 19:55229789-55229811 TTGCAAATATAAATAAAGGAAGG - Exonic
926534148 2:14089545-14089567 CTACATATATAAGAGAAAGTGGG + Intergenic
927257979 2:21057217-21057239 CAGCACCTATAAATGAAGCTGGG + Intergenic
927396959 2:22663288-22663310 GTGAATAAATAAATGAATGTGGG + Intergenic
928012443 2:27622473-27622495 CTCCATATATAAAAGAGGATAGG - Exonic
930394171 2:50799147-50799169 CGGCATATATAAATGAACAGAGG - Intronic
930675323 2:54194950-54194972 ATGAATATTCAAATGAAGGTAGG + Intronic
930780553 2:55221290-55221312 CTGCATAAATAAATTAGGATTGG + Intronic
931188733 2:59979099-59979121 CAGCATGTATAAATGATGCTAGG - Intergenic
931908939 2:66873270-66873292 CTGCACACATAAATGATGCTAGG + Intergenic
932538989 2:72631363-72631385 CTCCATATATATATGTAGGATGG - Intronic
933916733 2:87002243-87002265 CTACATATATACATGAGTGTTGG + Intronic
934006261 2:87767671-87767693 CTACATATATACATGAGTGTTGG - Intronic
935396256 2:102612394-102612416 CTGAATATATATTTGAAGGTAGG - Intergenic
935398169 2:102632182-102632204 ATATATATATAAATGAAAGTGGG + Intronic
935452008 2:103220686-103220708 CTGCATGTTAAGATGAAGGTTGG - Intergenic
935474595 2:103503129-103503151 CTGCAAATGTAATTAAAGGTAGG + Intergenic
935535792 2:104293069-104293091 CTGTATATAGAATTCAAGGTTGG + Intergenic
935769911 2:106408561-106408583 CTACATATATACATGAGTGTTGG - Intronic
935910183 2:107887362-107887384 CTACATATATACATGAGTGTTGG + Intronic
935968301 2:108504208-108504230 CTACATATATACATGAGTGTTGG + Intronic
936421863 2:112373562-112373584 CTACATATATACATGAGTGTTGG - Intronic
936631123 2:114204018-114204040 ATGAATATATAAATGATTGTAGG + Intergenic
937239203 2:120449484-120449506 CTCCAAGGATAAATGAAGGTTGG - Intergenic
937470671 2:122171594-122171616 TTGCATATTTAAATGAGGTTGGG + Intergenic
937658646 2:124405442-124405464 CTGCATATATAAGTGGAGTCCGG - Intronic
939150817 2:138470498-138470520 CTGCATACAGAAATTAAGTTTGG + Intergenic
939655024 2:144813742-144813764 CTCCATATTTAAAAGGAGGTGGG - Intergenic
941069509 2:160940168-160940190 CTGCAAATTTAAATGGAAGTGGG - Intergenic
942359507 2:175157325-175157347 CTGCATAGATACATGAAGTGGGG - Intronic
942575162 2:177355526-177355548 CTCCACATAGCAATGAAGGTAGG + Intronic
944295936 2:198062371-198062393 CTGTATATTTGAATGGAGGTTGG + Intronic
945522152 2:210842346-210842368 CTGAATATATAAAGAAAAGTGGG + Intergenic
946082617 2:217136147-217136169 CTGCATCTGTTAATGTAGGTTGG + Intergenic
947510564 2:230749554-230749576 CTGCATGTATAGATAAAGATGGG + Intronic
948070929 2:235124091-235124113 CTGAATGTATAAATCAAAGTTGG + Intergenic
1168937864 20:1682894-1682916 GTGGATATAGAAATGAATGTGGG + Intergenic
1170055181 20:12194328-12194350 CTGCTTAAATAAATGATTGTTGG - Intergenic
1170886163 20:20341465-20341487 CTGCATAAATAAATTAAATTTGG - Intronic
1172224486 20:33296187-33296209 CTGCTGATAGAAATGAAGGATGG + Intronic
1172435934 20:34928948-34928970 CTGCCTATAGAAATGGAGGCAGG + Exonic
1172872673 20:38145402-38145424 CTAAATAAATAAATGAATGTGGG - Intronic
1175134773 20:56815026-56815048 CTGCCTATAAGAATGAAAGTGGG - Intergenic
1176852092 21:13928238-13928260 CTGCATTTAGAAATGAAGCGGGG - Intergenic
1178869990 21:36365535-36365557 ATGCATATATAAATCAAAGAGGG + Intronic
1180212905 21:46306205-46306227 TTGCATTTAAAAATAAAGGTAGG + Intronic
1184870561 22:47235281-47235303 CTGCATGTATATATGATGGGTGG - Intergenic
1184892036 22:47386022-47386044 CTGGATGAATAAATGAAGGAAGG - Intergenic
949107907 3:222890-222912 CTGGCTATAAAAATGAAGGATGG - Intronic
951233808 3:20211191-20211213 CTGCATATAGAAATGATATTGGG - Intergenic
953291094 3:41663748-41663770 CTGGATATAGAATTCAAGGTTGG - Intronic
953669015 3:44947078-44947100 CTGAATCTACAAATGATGGTAGG + Intronic
956589875 3:70903424-70903446 CTGAATATCCAAATGAAAGTAGG - Intergenic
957330928 3:78762412-78762434 CTGGAAATATAAATGAAATTAGG - Intronic
959498907 3:107082596-107082618 CTGGGTTTCTAAATGAAGGTTGG + Intergenic
960498920 3:118411644-118411666 CAGCATATCAAAATGAAAGTAGG - Intergenic
960583359 3:119298955-119298977 CTGCACATGTAAATCAGGGTGGG - Intronic
960803761 3:121563458-121563480 ATGCATAAATAAATGAAAGTTGG + Intergenic
961697007 3:128712381-128712403 CTGAATAAATAAATGAAAGATGG + Intergenic
962019933 3:131488770-131488792 CTGCCTATATAAATCCAGGTTGG - Intronic
962248918 3:133822841-133822863 CTGCGCATTTAAATGAAGGTAGG - Intronic
963801646 3:149682204-149682226 CTGCAGATACCAATGATGGTTGG - Intronic
964693787 3:159484072-159484094 CTGCATTTAAAAATGAGAGTGGG + Intronic
965495209 3:169389750-169389772 CAGCATATCTAAAAGAAGGCAGG + Intronic
966308953 3:178572148-178572170 CAGCATATACAAAAGAAGGGTGG + Intronic
966549846 3:181193040-181193062 ATGAATATGTAAAAGAAGGTAGG + Intergenic
967694949 3:192519755-192519777 CTGAATACATAAATAAATGTAGG - Intronic
971195154 4:24466239-24466261 CTGGTTATATAAAAGAAAGTGGG + Intergenic
973028711 4:45308403-45308425 CTGAATATATAAATCAAGTTGGG + Intergenic
974381329 4:61144105-61144127 TTTCCTATATAAGTGAAGGTAGG + Intergenic
974540894 4:63233677-63233699 CTGCATATATCAGTGATGATGGG + Intergenic
975182221 4:71359404-71359426 CTGGATATTTAAAAGAAGTTAGG - Intronic
977296400 4:95214309-95214331 CTGTTTATAAAAATGAAGCTAGG - Intronic
977484772 4:97629039-97629061 ATGCATATACAAATGAATATGGG - Intronic
977910147 4:102524891-102524913 CTGTATATACAGATGAAGCTTGG + Intronic
978878179 4:113667298-113667320 CTGAATAAATGAATGAAGGATGG + Intronic
979155821 4:117389240-117389262 TTGCATTGATAAATGAATGTAGG + Intergenic
979633155 4:122925887-122925909 CTGAATGAATAAATGAAGGGTGG + Intronic
979792042 4:124796606-124796628 CTGAAGTCATAAATGAAGGTAGG + Intergenic
981768435 4:148278763-148278785 CTGCATATGTTAACGAATGTGGG - Intronic
982107062 4:152020336-152020358 CTGCAAATATAAATTAAAGGTGG + Intergenic
982949359 4:161670184-161670206 TTGCATATACATATGAAGGAAGG + Intronic
983721034 4:170851723-170851745 ATGCATATATAAGTGGAGGGAGG + Intergenic
983766582 4:171491530-171491552 CTGAATATATAAATGGATGATGG + Intergenic
984462027 4:180049896-180049918 ATATATATATAATTGAAGGTTGG - Intergenic
985211335 4:187598764-187598786 ATAGGTATATAAATGAAGGTGGG + Intergenic
986994290 5:13589299-13589321 CTGAATAAATAAATAAAGGGAGG + Intergenic
987058143 5:14215492-14215514 GGCCATATATAAAAGAAGGTTGG - Intronic
987552536 5:19402756-19402778 ATGCATACATAAATAATGGTTGG - Intergenic
987782745 5:22460538-22460560 CTGCAAATAAAAACGAAAGTGGG + Intronic
987867058 5:23556406-23556428 CTGTATATCTAAATGAACTTAGG - Intergenic
990452768 5:55951504-55951526 CAGCATACACAGATGAAGGTGGG - Exonic
992321073 5:75613480-75613502 CTGCATATATAAATGAAGGTAGG + Intronic
993914119 5:93720924-93720946 CAGAATATACACATGAAGGTGGG - Intronic
994874159 5:105393241-105393263 CTGCATATGTAATTGGAGGAAGG - Intergenic
995809596 5:116089923-116089945 CGGGATACATAAATGAAAGTAGG - Intronic
996104586 5:119484490-119484512 TTGCATAAGTAAATAAAGGTAGG - Intronic
996314469 5:122146240-122146262 CTAAATATAGAAAAGAAGGTTGG + Intronic
1000521100 5:162295495-162295517 CTAAATATCTTAATGAAGGTAGG - Intergenic
1001341102 5:170846244-170846266 GTGCATATATAAATGCAATTGGG - Intergenic
1002931627 6:1638979-1639001 CTGCATGTATGAACGAATGTTGG - Intronic
1003250233 6:4421820-4421842 CTGGATACATAATTGTAGGTTGG - Intergenic
1004678492 6:17868465-17868487 CTGCATGTATATATGAAGTTCGG + Intronic
1004969852 6:20897592-20897614 CTGAATATATAACTGAAGATTGG - Intronic
1005646935 6:27848428-27848450 CTTCAAATGTAAATAAAGGTAGG + Intronic
1007319429 6:41016587-41016609 CTGCAACGATAAATGAAGATGGG + Intergenic
1011888235 6:92124830-92124852 ATGCATATATGAATGAATGAAGG - Intergenic
1012142290 6:95638626-95638648 CTGAATATATAAGTGGTGGTGGG + Intergenic
1017078874 6:150647260-150647282 CTGCATATAAAAAGCAAGATTGG + Intronic
1017807566 6:157959092-157959114 TTCCATATATTCATGAAGGTAGG - Intergenic
1018372780 6:163183620-163183642 CTGTAGGTATAAATCAAGGTTGG - Intronic
1020460163 7:8421176-8421198 ATGAATAAATAAATGATGGTTGG - Intergenic
1020829487 7:13076019-13076041 CTGGATATGGAAATAAAGGTTGG + Intergenic
1021246700 7:18271911-18271933 ATGCATCCATAAATGAAGGAAGG + Intronic
1022514647 7:30967713-30967735 CTGCATAAAAAAAGGAAGGAGGG - Intronic
1022937614 7:35195678-35195700 CTGAATATATAGATCAAGTTGGG + Intergenic
1023143775 7:37129119-37129141 TTGTCTATATAAATGATGGTAGG - Intronic
1023507068 7:40910852-40910874 TTACATATAGAAATGATGGTAGG + Intergenic
1024441232 7:49420508-49420530 CTGGACATATAATTGTAGGTAGG + Intergenic
1026316025 7:69228396-69228418 CTGCAAATACAGATGAAGCTTGG + Intergenic
1026381630 7:69805738-69805760 CTTCATAGAGAAATAAAGGTTGG - Intronic
1028212851 7:88096391-88096413 ATGCATATAGAAAAGAAGATTGG - Intronic
1028905793 7:96152660-96152682 CCACATATATAACTGAAGGCAGG + Intronic
1030434434 7:109498642-109498664 GTGAATATAGAATTGAAGGTTGG + Intergenic
1030444710 7:109634953-109634975 CTGCATATTTAAATGCAAGCAGG + Intergenic
1030755913 7:113287700-113287722 CTGCATATATAACTCAAGGTTGG - Intergenic
1033445736 7:141420338-141420360 ATGAATAAATAAATGAATGTAGG + Intronic
1035148640 7:156846612-156846634 CTGAATGTATAGATGAAGTTGGG - Intronic
1038657330 8:29465761-29465783 CTGTAAATATAGATGAAGCTTGG - Intergenic
1039145872 8:34446412-34446434 CACCATATACAAATGAAGTTTGG + Intergenic
1039177721 8:34828005-34828027 ATGCATTTCTAATTGAAGGTGGG + Intergenic
1041376792 8:57214360-57214382 CTGGAAATATGCATGAAGGTGGG + Intergenic
1041577481 8:59416022-59416044 TTGAATATATAAATGAAGCAGGG - Intergenic
1041657902 8:60372579-60372601 CTGCATATATACTTTCAGGTTGG + Intergenic
1042146880 8:65739011-65739033 CTGCATGCAGAAGTGAAGGTGGG + Intronic
1043441394 8:80279725-80279747 TTACATAGATAAATGAGGGTGGG + Intergenic
1045074174 8:98544134-98544156 CTGGATATAGAAGTGAAGGGAGG + Intronic
1045605742 8:103772588-103772610 CTGTATATATAAATCAAATTGGG - Intronic
1047139804 8:122125131-122125153 CTTCATAAATAAATTAAGGTAGG + Intergenic
1048173754 8:132133165-132133187 CTGCATCCCTAAAAGAAGGTAGG + Intronic
1048582297 8:135739703-135739725 ATGCATATAGAAAACAAGGTGGG - Intergenic
1048873766 8:138820699-138820721 ATGAATATATATATGCAGGTAGG - Intronic
1050039207 9:1471096-1471118 CTGTGTATATAAATGGAGCTGGG + Intergenic
1050594282 9:7190367-7190389 CTGGATATAGAATTCAAGGTTGG - Intergenic
1054361385 9:64123924-64123946 CTGCATTTAGAAATGAAGTAGGG + Intergenic
1055225889 9:73994777-73994799 CTGCAAATAAAAATCAAGATTGG - Intergenic
1055880263 9:80992804-80992826 TTGAATATATAGATGAAGCTGGG + Intergenic
1056403140 9:86247866-86247888 CTGCCTCTATAATGGAAGGTAGG - Intronic
1056996387 9:91464774-91464796 CTGCATATAAAAGTCTAGGTTGG + Intergenic
1057097983 9:92329480-92329502 CTTCATATATAAATGATGTGCGG - Intronic
1059237065 9:112770074-112770096 CTGGATATATGACTGAAGGTGGG - Intronic
1059960926 9:119563771-119563793 CTGCATATATGCATGTACGTGGG - Intergenic
1186053255 X:5622974-5622996 CTACATATATAAATTAATATTGG + Intergenic
1188422289 X:30004896-30004918 CTTCATTTATCAAAGAAGGTTGG + Intergenic
1189831064 X:44973510-44973532 CTGGATATATAATTTTAGGTTGG + Intronic
1192549532 X:72042866-72042888 TTGAATAAATAAATGAAGGAAGG + Intergenic
1192617793 X:72646041-72646063 CTGCATGTATAGAGGGAGGTGGG + Intronic
1193355147 X:80511700-80511722 TTGCATATATAAATCAATGGGGG - Intergenic
1193893121 X:87076355-87076377 CTGCATAAGTGAATGAATGTTGG + Intergenic
1194891078 X:99380051-99380073 CTGAATACATAAATGAAGTTGGG - Intergenic
1195370837 X:104170666-104170688 TTGAAAATATAAAAGAAGGTGGG + Intronic
1195373486 X:104202647-104202669 CTGAATAAATAAATAAAGGCTGG - Intergenic
1195814634 X:108871317-108871339 ATTTAAATATAAATGAAGGTTGG + Intergenic
1196253557 X:113489466-113489488 CTGGAAATACAAATGAAGGAAGG + Intergenic
1196654797 X:118206467-118206489 ATGCATATATAAATGTACATGGG + Intergenic
1197555723 X:127950259-127950281 CTTCACATATAAATGAAGCTGGG + Intergenic
1197692542 X:129518546-129518568 CTAAATATATAAATCAATGTGGG + Intronic