ID: 992321980

View in Genome Browser
Species Human (GRCh38)
Location 5:75622487-75622509
Sequence GAGCAGCAACCCCGAGTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 134}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992321975_992321980 10 Left 992321975 5:75622454-75622476 CCATTCAAGGCACTGCATGCTAG 0: 1
1: 0
2: 2
3: 6
4: 88
Right 992321980 5:75622487-75622509 GAGCAGCAACCCCGAGTCCTGGG 0: 1
1: 0
2: 0
3: 12
4: 134
992321974_992321980 21 Left 992321974 5:75622443-75622465 CCAGCTGAGTACCATTCAAGGCA 0: 1
1: 0
2: 0
3: 12
4: 74
Right 992321980 5:75622487-75622509 GAGCAGCAACCCCGAGTCCTGGG 0: 1
1: 0
2: 0
3: 12
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992321980 Original CRISPR GAGCAGCAACCCCGAGTCCT GGG Intronic
900717971 1:4157260-4157282 GAGCAACAGCCCCGGATCCTAGG - Intergenic
900875741 1:5341397-5341419 CAGCAGCAACACCGAGTCTCAGG + Intergenic
902226828 1:15001538-15001560 GAGCAGCAGCCCCTACTCCCTGG + Intronic
902800811 1:18828893-18828915 AGGCAGCAACCCCGAGGGCTGGG + Intergenic
904366275 1:30012814-30012836 AAACAGCAGCCCCGTGTCCTGGG + Intergenic
904614359 1:31742053-31742075 GTGCAGCAACCTCGAGTGCCCGG - Exonic
904782796 1:32963844-32963866 TAGCAGCCACCTCGAGCCCTGGG + Intronic
904881581 1:33701403-33701425 GAGCAGCAACCTTGAAACCTGGG - Intronic
904925000 1:34040608-34040630 GAGCAGCCACACAGAGTCTTAGG + Intronic
906551568 1:46670112-46670134 GAGAACCCACCCCAAGTCCTGGG + Intronic
907958790 1:59258263-59258285 GAGAAGCAACCCAGAGACCCAGG + Intergenic
911682120 1:100729132-100729154 GAGCAGCAATCCGGGGTCCAGGG - Exonic
918150282 1:181792373-181792395 GAGCAGCAGCCCCGAGGGATGGG - Intronic
918166144 1:181949368-181949390 CAGCATTAACCCCGAGTCCAAGG - Intergenic
918349272 1:183636362-183636384 GAGCAGGAAGCCCGTTTCCTGGG + Exonic
919653986 1:200180150-200180172 CAGCAGCAGCCCCCTGTCCTCGG + Intergenic
920651150 1:207838382-207838404 GAGCAGAGACCCAGAGCCCTGGG - Intergenic
921945659 1:220884368-220884390 GAGCAGCGACTCCGAGTCCCTGG + Exonic
1063768424 10:9169460-9169482 GAGCAGCAACCCCCAAACCTGGG + Intergenic
1064391007 10:14942178-14942200 GTGCAGCTCCTCCGAGTCCTGGG + Intronic
1064401370 10:15024187-15024209 GTGCAGCTCCTCCGAGTCCTGGG + Intergenic
1064742803 10:18450513-18450535 GAGAAGGAACACCCAGTCCTGGG - Intronic
1066065752 10:31759882-31759904 GAGCAGAAACGCCGTTTCCTGGG - Intergenic
1066296787 10:34060775-34060797 GTCCAGCAGCCCCAAGTCCTAGG - Intergenic
1067683039 10:48452114-48452136 GAGATGCAGCCCCCAGTCCTGGG + Intronic
1068762878 10:60732968-60732990 AAGCAGAAGCCCCAAGTCCTCGG + Intronic
1069684298 10:70307957-70307979 GAGCAGCAGCCCAGATGCCTGGG + Intronic
1069893326 10:71665484-71665506 GAGCAGCAACCCAGAGATCTGGG + Intronic
1071569425 10:86688535-86688557 GAGCAGCAGCCCTGAGCCTTGGG - Intronic
1073636530 10:105204411-105204433 CAGCAGTAAACCCAAGTCCTTGG - Intronic
1075519872 10:123136876-123136898 GAGAAGGGACGCCGAGTCCTGGG - Intronic
1076510617 10:131011576-131011598 GAGGAGCACCCCAGAGCCCTCGG + Intergenic
1076546597 10:131249486-131249508 AAGCAGCATCCCTGAGTCCCTGG + Intronic
1078527718 11:12112669-12112691 GAGCAGAAAGCCAGAGCCCTAGG - Intronic
1079017291 11:16879938-16879960 AAGTAGCAACCCCAAGTCATGGG - Intronic
1089833424 11:121349167-121349189 GAGGAGCAATCCCAAGTCCAGGG - Intergenic
1091551724 12:1540166-1540188 CAGCAGCAACGCCGAGTGGTGGG - Intronic
1092247638 12:6872508-6872530 GGGCAGCAACAGCGAGTCGTGGG - Exonic
1094594560 12:31853190-31853212 GAGAGGCAAGCCTGAGTCCTGGG + Intergenic
1098293543 12:68981400-68981422 GAGTAGCTACCCCAAGTTCTGGG + Intergenic
1100377391 12:94030075-94030097 GGACAGCAACCCCAACTCCTAGG + Intergenic
1102558561 12:113746007-113746029 GTGCAGAGACCCTGAGTCCTGGG + Intergenic
1102689069 12:114746361-114746383 GAGCATCAACCCCGCATCCTTGG - Intergenic
1104521227 12:129477157-129477179 CAGCAGCAACCCCGTCTCCTTGG + Intronic
1105499055 13:20955547-20955569 GAACAGCAAGCTCGAGTACTGGG - Intergenic
1107468097 13:40666972-40666994 GAGCAGCAGAGCCGAGTACTCGG + Intergenic
1112372328 13:98804647-98804669 CAGCAGCCACACCCAGTCCTGGG - Intronic
1113972489 13:114200477-114200499 CAGCACCAAACCCGAGTGCTGGG + Intergenic
1117346865 14:54841424-54841446 GAGCAGCAGGCCCCAGTACTTGG + Intergenic
1119528528 14:75342407-75342429 TACCAGGAACCCCGAGTACTAGG + Intergenic
1121193681 14:92051430-92051452 GAGCAGGAAAACAGAGTCCTGGG - Exonic
1129201879 15:74007651-74007673 GGGCAGACACCCCGAGTCCCAGG - Intronic
1130833637 15:87628530-87628552 GAGCAGCAACCAGGAGTCAGAGG - Intergenic
1133078052 16:3295207-3295229 GAGCGGCAGCCCCGAGGCCCGGG - Intronic
1136519623 16:30787119-30787141 GAGAAGGACCCCAGAGTCCTCGG - Exonic
1137787880 16:51152337-51152359 GAGAAGCAGCCCCGAGCCCGTGG + Intergenic
1139667858 16:68470909-68470931 GATCAGGAACCCCGAGGCCGGGG + Intergenic
1143543425 17:7582793-7582815 GAGCAGCACCCCCCAGCCGTAGG + Intergenic
1143866157 17:9925607-9925629 GAGCAGCTTCTCCGTGTCCTTGG - Intronic
1145059404 17:19723233-19723255 GAGCTGCCACCCCAAGCCCTGGG + Intergenic
1146660723 17:34663563-34663585 GAGCAGCAAGCAGGTGTCCTGGG + Intergenic
1156340160 18:36203462-36203484 GAGGAGCATCCCTGGGTCCTGGG + Intronic
1160021713 18:75186603-75186625 GAGCTGGAGCCCCTAGTCCTAGG - Intergenic
1160860242 19:1234538-1234560 GGGCAGCAGCCCCGGTTCCTCGG - Intronic
1161939732 19:7395004-7395026 GAGCAGCAGCCCCAGGTCCCCGG + Intronic
1163134803 19:15302269-15302291 AAGCAGCATCTCCCAGTCCTGGG - Intronic
1163568148 19:18064020-18064042 GAGAGGCAACCCTGAGTCCTGGG + Intronic
1163697048 19:18769240-18769262 GAGCTGCAGCCCCCAGCCCTGGG - Intronic
1166855560 19:45781292-45781314 GACCAGTGAGCCCGAGTCCTGGG + Intronic
1166983913 19:46648796-46648818 GGGCAGCGACTCCGAGTGCTCGG - Exonic
1167035504 19:46992981-46993003 GAGAAGCACCCCCGTGCCCTCGG - Intronic
1167250340 19:48395806-48395828 GAGCCGGAACCCGGACTCCTGGG + Intronic
1167852521 19:52212950-52212972 CAGCAGCCGCACCGAGTCCTAGG - Exonic
931431733 2:62214018-62214040 GAGCAGATACCCTGACTCCTGGG + Intronic
932910915 2:75805340-75805362 GAGCAGCAACCTCGGGTAGTAGG + Intergenic
933645643 2:84810683-84810705 GAGCAGCACCCAGGAGTCTTGGG + Intronic
934562375 2:95319996-95320018 GACCAGCAAGCCCCAGCCCTCGG - Intronic
935567206 2:104621317-104621339 CAGCTGCAACCCCTAGTCCGAGG + Intergenic
935622681 2:105143610-105143632 GAGCAGCAAAACTGAGACCTGGG - Intergenic
944399225 2:199306101-199306123 GAATTCCAACCCCGAGTCCTTGG + Intronic
947736921 2:232459889-232459911 GGGCAGCAACCCAGAGCCCATGG + Exonic
948129285 2:235588467-235588489 TAGCAGCCACCGGGAGTCCTGGG - Intronic
948824575 2:240568200-240568222 GAGCAGCGATCCCGCCTCCTGGG + Intronic
1169292566 20:4365185-4365207 GACCAACCACCCAGAGTCCTGGG - Intergenic
1170105665 20:12752327-12752349 TAGCAGAAACCCAGAGTCCTAGG - Intergenic
1170723688 20:18906300-18906322 GAGCAGAAACCATGAGTACTTGG + Intergenic
1170783263 20:19446096-19446118 GAGCAGCAACTTGGGGTCCTGGG - Intronic
1171025632 20:21628210-21628232 GAGCAGCAAAACTGAGTCCCCGG + Intergenic
1172355438 20:34276646-34276668 GAGAAGCAGCCTCTAGTCCTGGG + Intergenic
1172702693 20:36862903-36862925 GAGCAGCGACGCCGAGTCCGCGG - Exonic
1173176435 20:40768220-40768242 GAGGAGCAACCCAGAGTCAAGGG - Intergenic
1175079119 20:56403522-56403544 GGGCAGCAACACATAGTCCTCGG - Exonic
1177626797 21:23672505-23672527 GGGCAGCTATCCTGAGTCCTGGG + Intergenic
1182393640 22:30019885-30019907 GAGCAGCATCACCCAGTTCTGGG - Exonic
1184254198 22:43277912-43277934 GAGCTGCAACCCAGAGGGCTAGG - Intronic
1184871118 22:47239091-47239113 GAGGAGCACCCCAGAGTCCAGGG + Intergenic
954393007 3:50277156-50277178 CAGCAGAAAACCCCAGTCCTCGG + Intronic
954610771 3:51943517-51943539 CAGCAGCAACCCCGGGACCCAGG + Exonic
960004243 3:112765839-112765861 GAGTAGCACCCAAGAGTCCTGGG + Intronic
960454579 3:117854820-117854842 GAGCAGCACCGCAGAGTCCCTGG + Intergenic
962241830 3:133756578-133756600 CAGCACCAACCCCCAGTCTTTGG - Intronic
968161786 3:196432563-196432585 GAGCAGCCAACCCGAGAGCTGGG - Intergenic
968730764 4:2268252-2268274 GAGCAGCATCCCCGTGTTGTAGG - Intergenic
973845697 4:54910866-54910888 GAGCAGGAAAACCGAATCCTGGG + Intergenic
975838984 4:78454528-78454550 GAGCAGCACCCCCAAGACCTTGG + Intronic
977446076 4:97134595-97134617 CAGCAGCAACCAGAAGTCCTAGG - Intergenic
978399315 4:108314124-108314146 GAGGAGCATCCCTGAGTCCCTGG - Intergenic
982782677 4:159507373-159507395 GAGCAGCAGTCCCCAGTCCCTGG - Intergenic
983754763 4:171320762-171320784 GAGCAGCAACCCTTAATCCCTGG + Intergenic
985625169 5:981991-982013 GAGCAGAGACCCCAAGACCTCGG + Intergenic
985625209 5:982139-982161 GAGCAGAGACCCCAAGACCTCGG + Intergenic
985625228 5:982213-982235 GAGCAGAGACCCCAAGACCTCGG + Intergenic
990334087 5:54755420-54755442 GGGCAGCAGCCCCTAGTCTTTGG + Intergenic
992321980 5:75622487-75622509 GAGCAGCAACCCCGAGTCCTGGG + Intronic
997225315 5:132205299-132205321 GAGCAGCAATCCAGAGGCCTGGG + Intronic
1001586756 5:172838030-172838052 CAGCGGCACCCCCGAGGCCTTGG - Intronic
1002394073 5:178939959-178939981 GAGTAAGAACCCCGAGTCCAGGG - Intergenic
1002639321 5:180623298-180623320 CAGCAGCAATCCCGAGGCCCAGG + Intronic
1002898194 6:1391018-1391040 CAGCAGCAACCCCGCCGCCTCGG + Exonic
1006521258 6:34572586-34572608 GAGAAGAAAGCCCGAGTCCCTGG + Intergenic
1007115768 6:39342178-39342200 GAGCAGCTACGCCGCGTTCTGGG - Intronic
1008845400 6:55957373-55957395 GAGAAGAAACCCCGAGTGCTGGG + Intergenic
1011406041 6:87016282-87016304 GAGCATCTACACCGTGTCCTCGG + Exonic
1013317713 6:108957908-108957930 ACTCAGCAACCCTGAGTCCTTGG + Intronic
1019178912 6:170175383-170175405 GGCCAGCACCCCCAAGTCCTGGG + Intergenic
1023749026 7:43352098-43352120 GAGAAACAACCCCAAATCCTGGG + Intronic
1034447182 7:151119753-151119775 GGGCAGCAAACCCTCGTCCTGGG - Intronic
1035169600 7:157010161-157010183 CAGCTGCAGCCCCGCGTCCTCGG - Exonic
1036242634 8:7092585-7092607 GAGGGGCAGCCCCGTGTCCTGGG + Intergenic
1036258173 8:7221444-7221466 GAGGGGCAGCCCCGCGTCCTGGG - Intergenic
1036310222 8:7680040-7680062 GAGGGGCAGCCCCGCGTCCTGGG - Intergenic
1036359315 8:8066063-8066085 GAGGGGCAGCCCCGCGTCCTGGG + Intergenic
1036891642 8:12600889-12600911 GAGGGGCAGCCCCGCGTCCTGGG - Intergenic
1039469189 8:37803032-37803054 GAGTGGCAACCCCTCGTCCTGGG + Intronic
1042560393 8:70069494-70069516 GAGCAGCAGCCACGAGTACGCGG - Exonic
1043379760 8:79689859-79689881 TAGCACCAACCTCTAGTCCTAGG - Intergenic
1044115533 8:88328812-88328834 GGGCAGCAACCACCAGCCCTTGG + Intergenic
1049254204 8:141605239-141605261 GGGCAGCAAGCCCGAGTCAGGGG + Intergenic
1049277073 8:141725256-141725278 GAGCAGGAGCCCCCAGGCCTGGG - Intergenic
1058431939 9:104927728-104927750 GCGCAGCAGCGCAGAGTCCTGGG + Intronic
1058826302 9:108778653-108778675 GAGCAGCTGCCCCCAGTCCCTGG + Intergenic
1059259127 9:112959116-112959138 GATCACCAACCCGGAGTCCTAGG + Intergenic
1061665925 9:132161262-132161284 GAGGAGCAGCCCTGAGCCCTTGG + Intergenic
1185639627 X:1581189-1581211 GAACAGCACCCGTGAGTCCTTGG - Intergenic
1199010784 X:142756193-142756215 CAGCAGCAGCCCCTAGCCCTTGG + Intergenic
1199595690 X:149504454-149504476 GAGGAGGAAGCCTGAGTCCTGGG + Intronic
1200274174 X:154716266-154716288 GAGCGGCAACCCCGATGTCTTGG - Exonic