ID: 992322100

View in Genome Browser
Species Human (GRCh38)
Location 5:75623562-75623584
Sequence CGGTGAGTTAGTCCATTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 50}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992322100_992322103 30 Left 992322100 5:75623562-75623584 CCTACAAATGGACTAACTCACCG 0: 1
1: 0
2: 0
3: 5
4: 50
Right 992322103 5:75623615-75623637 TAGGATATGCACATTAAGAGTGG No data
992322100_992322102 11 Left 992322100 5:75623562-75623584 CCTACAAATGGACTAACTCACCG 0: 1
1: 0
2: 0
3: 5
4: 50
Right 992322102 5:75623596-75623618 AGCTGAAATATAAATTTGATAGG 0: 1
1: 0
2: 2
3: 56
4: 570

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992322100 Original CRISPR CGGTGAGTTAGTCCATTTGT AGG (reversed) Intronic
906505041 1:46372620-46372642 CAGTGAGTTAGGCCATCTGGTGG - Intergenic
911090701 1:94014819-94014841 CAGAGAGATACTCCATTTGTTGG + Intronic
915983968 1:160444858-160444880 AGATGAGTTTGCCCATTTGTAGG - Intergenic
916586063 1:166151545-166151567 CAGTGAGTTTGTCCAATTGTTGG + Intronic
917713792 1:177713026-177713048 TGGTGGGTTATTGCATTTGTTGG - Intergenic
1065837080 10:29668360-29668382 CAGTGAGTTAGTGGTTTTGTAGG - Intronic
1068363537 10:56012748-56012770 CTGGGAGTTAGTCCAGTTCTAGG - Intergenic
1069685252 10:70313886-70313908 CGGTATATTAGTCCATTTTTAGG + Intronic
1072135115 10:92537805-92537827 GGGTGGGTTAGACCATGTGTTGG + Intronic
1074067687 10:110032276-110032298 CGGAGAAATAGTCCATGTGTTGG + Intronic
1084000452 11:66292820-66292842 ATGTGAGTGAGTCCCTTTGTGGG + Intronic
1092011012 12:5112651-5112673 CAGAGAGTAAGTGCATTTGTTGG + Intergenic
1093545469 12:20341122-20341144 CCGTTAGCTACTCCATTTGTTGG - Intergenic
1094392848 12:29971554-29971576 CGGTGAGTTAATCCCTATGCTGG + Intergenic
1125644160 15:41256989-41257011 GGGTGAGTCAGTACAGTTGTTGG + Exonic
1129588658 15:76894765-76894787 CTGTAAGTTATTCAATTTGTTGG - Intronic
1153272234 18:3334035-3334057 CTGTGAGTGACTCCATTTGGTGG + Intergenic
1153338045 18:3944820-3944842 TGGTGAGTTTCTCCATTTTTAGG - Intronic
1166307124 19:41941145-41941167 CGGGGAGGCAGTCCATTTGTGGG - Intergenic
926799290 2:16645212-16645234 AGGTGAGTTAATTCATTTGAAGG - Intronic
928610706 2:32989458-32989480 GGGTGAGTTAGACCTTTTTTTGG + Intronic
936458963 2:112697296-112697318 CAGTGAGTTAGCCCATTGGCGGG - Intergenic
941229774 2:162897229-162897251 CTGTTGGTTAGTCCATCTGTTGG + Intergenic
1180144924 21:45913615-45913637 CGGAGAGTCAGTCCCATTGTGGG - Intronic
1180645395 22:17334431-17334453 CAGAGAGTTTGTCCATTTCTGGG + Intergenic
1181665589 22:24394032-24394054 CTGAGTGTTAGTCCATTTTTTGG + Intronic
1185418856 22:50724090-50724112 CGCTGAGTAAGTCCTTCTGTGGG - Intergenic
966270725 3:178101896-178101918 TGTTGAGTTAGTCCATTATTTGG - Intergenic
967010468 3:185428369-185428391 CTGTGGGTTAGTCCATGTGATGG - Intronic
971478089 4:27090844-27090866 CCCTGACTTAGTCAATTTGTCGG - Intergenic
971652228 4:29292954-29292976 CAGTTAGTTAGTCCATATGTTGG - Intergenic
976486680 4:85613612-85613634 TGCTGAGTTTGTCCATTTTTTGG + Intronic
982745132 4:159098958-159098980 CAGTGAGTTAGTCATTTTGTTGG + Intergenic
986017606 5:3771287-3771309 CGGTGACCTAGTCCTTGTGTGGG - Intergenic
992322100 5:75623562-75623584 CGGTGAGTTAGTCCATTTGTAGG - Intronic
992581003 5:78175400-78175422 CTGTGAGTTATTCAAGTTGTAGG + Intronic
1001032172 5:168271018-168271040 CAGTGATTTATTCCATATGTAGG + Intergenic
1002275782 5:178103659-178103681 CAGTGAGTGAGTCCTTTTGAAGG - Intergenic
1005892901 6:30154389-30154411 TGGTGAGTTCTGCCATTTGTAGG + Exonic
1008766232 6:54918858-54918880 CGGGGAGTTACACCATTTGAGGG - Intronic
1013043406 6:106459523-106459545 AACAGAGTTAGTCCATTTGTGGG + Intergenic
1014391263 6:120868513-120868535 CTGTGTGTTTGTCTATTTGTGGG + Intergenic
1022169541 7:27811422-27811444 AGGTTACTTAGTCCATTTATTGG + Intronic
1024377815 7:48659097-48659119 GACTCAGTTAGTCCATTTGTAGG - Intergenic
1027433145 7:78134965-78134987 CGGTGAGTGTGTCCATGTGTTGG + Intronic
1027597264 7:80189230-80189252 CGGTAAGTTATTAAATTTGTTGG + Exonic
1034480768 7:151319031-151319053 CGGTTAGTGAGGCCTTTTGTAGG + Intergenic
1043747643 8:83896143-83896165 TGGTGAGTTATTCAATTTGAGGG + Intergenic
1051047858 9:12897050-12897072 TGGGGAGTTTGTGCATTTGTTGG - Intergenic
1051270129 9:15347424-15347446 CGGTGAGTTGGTCTGTCTGTTGG - Intergenic
1060962879 9:127693559-127693581 CGGGGAGTGAGACCCTTTGTAGG + Intronic
1203570212 Un_KI270744v1:122481-122503 CTGCGAGTTAGTACATTAGTAGG - Intergenic
1188123983 X:26345084-26345106 CATTAAGTTAGTCCTTTTGTTGG - Intergenic
1195574320 X:106432800-106432822 CTGTGATTTTGTCCATTTTTTGG - Intergenic
1196624423 X:117862059-117862081 TGGTGATTTAACCCATTTGTGGG - Intergenic
1200203420 X:154298116-154298138 TTGTAGGTTAGTCCATTTGTTGG + Intronic