ID: 992324981

View in Genome Browser
Species Human (GRCh38)
Location 5:75651634-75651656
Sequence TCACCTATTTGGTTCAAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 120}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992324977_992324981 0 Left 992324977 5:75651611-75651633 CCTTTCTTGGGGCTAATACCAAG 0: 1
1: 0
2: 0
3: 8
4: 96
Right 992324981 5:75651634-75651656 TCACCTATTTGGTTCAAAGAGGG 0: 1
1: 0
2: 1
3: 9
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992324981 Original CRISPR TCACCTATTTGGTTCAAAGA GGG Intronic
900858572 1:5206338-5206360 TCACACATAAGGTTCAAAGAGGG - Intergenic
902852291 1:19169255-19169277 TCACCTAGTTGGTTCTCATATGG - Intronic
902941760 1:19805167-19805189 TCAGTTCTTTGGGTCAAAGATGG - Intergenic
905351587 1:37350414-37350436 TCACCTATTTGCCTTAAAGTGGG - Intergenic
905921893 1:41725142-41725164 TCAGCTGTTTCATTCAAAGATGG - Intronic
908955064 1:69615004-69615026 CCAAATATTTGGCTCAAAGATGG - Intronic
910976323 1:92909972-92909994 TGATTTATTTGGTACAAAGAAGG - Intronic
916162579 1:161933603-161933625 TCACCTATTTTGTTAAATTAGGG - Intronic
917569378 1:176248910-176248932 TCAACTTTTTTGTTAAAAGATGG - Intergenic
918241684 1:182625894-182625916 TCAGCTATTTGCTTGAATGAAGG - Intergenic
924906441 1:248458172-248458194 CCTCCTGTTTGCTTCAAAGAAGG - Intergenic
924921446 1:248633854-248633876 CCTCCTGTTTGCTTCAAAGAAGG + Intergenic
1064419594 10:15179427-15179449 ACACATATTCTGTTCAAAGAGGG + Intergenic
1066663880 10:37763275-37763297 TCAGCCATTTGGTTCACAGCAGG + Intergenic
1070103110 10:73407043-73407065 TCAACTACGTTGTTCAAAGAAGG - Intronic
1079587162 11:22140074-22140096 TCAGCTTTCTGGTTCATAGACGG - Intergenic
1079768491 11:24426567-24426589 TCACCTACGTTGTTCAATGAGGG - Intergenic
1094781286 12:33794951-33794973 TAACCTCTTGGGTTCAAAGTTGG + Intergenic
1095838516 12:46665817-46665839 TCAACTATTTGGAACAAGGATGG + Intergenic
1099300988 12:80893967-80893989 CCACCTATTTGTTTCCAAAACGG - Intronic
1099849713 12:88076804-88076826 GGACCTATTTGGGTCAAAGTGGG + Intronic
1100054801 12:90496155-90496177 TCCCCTGTTTTGTTCCAAGATGG + Intergenic
1113014410 13:105811678-105811700 TCAACTGGTTGGTTCATAGAAGG - Intergenic
1114764199 14:25351679-25351701 TCACTTATTTGTTACACAGAAGG + Intergenic
1116650132 14:47579960-47579982 TTACATAGTAGGTTCAAAGAGGG + Intronic
1117440650 14:55756095-55756117 GCACCTCTTGGGTTCCAAGAGGG + Intergenic
1119928322 14:78518744-78518766 TGCCCTAATTGGTTCACAGATGG + Intronic
1119992056 14:79209337-79209359 TCACCTATTTCCTTAGAAGAGGG + Intronic
1120796782 14:88642385-88642407 TCACCTTCTTGGATCAAACAAGG + Intronic
1121391328 14:93577433-93577455 TGACCTGATTGGTTAAAAGATGG - Intronic
1129946688 15:79544315-79544337 ACAAATATTTGCTTCAAAGAGGG - Intergenic
1130051828 15:80490278-80490300 TGACTTATTTGCCTCAAAGAGGG - Intronic
1131526291 15:93155339-93155361 TCAGCTTTCTGGTTCATAGATGG - Intergenic
1136527487 16:30841565-30841587 TCAGCTGTTTGGTTCACAGCAGG - Intronic
1137898121 16:52236252-52236274 TGAGCTATTTGGGACAAAGAGGG + Intergenic
1140673896 16:77307318-77307340 TGACTTATTTGCTTCAAAGCTGG + Intronic
1144221756 17:13106233-13106255 TCACCTAGTGAGTTCAGAGACGG + Intergenic
1144284233 17:13757366-13757388 TCACCGAGGAGGTTCAAAGAAGG + Intergenic
1146445762 17:32931751-32931773 TCAGCTTTTTGGTTCTAAAATGG + Intronic
1146619546 17:34386729-34386751 GCACCTATTGGGTGCAAAGTGGG + Intergenic
1149032056 17:52095155-52095177 TCACCTATGTTGTTCAAGGTAGG - Intronic
1152253791 17:79225811-79225833 TAACCTGTTTGGTTCAAAGCTGG - Intronic
1155265417 18:24088210-24088232 TCACATTTTTATTTCAAAGATGG + Intronic
1157942205 18:51941816-51941838 TCCCATGTTTGGTCCAAAGATGG + Intergenic
1163021926 19:14486342-14486364 CCACCTGTTTGGTCCAAAGGGGG - Intronic
1164421818 19:28100251-28100273 TCACTAATTTGCTCCAAAGAAGG - Intergenic
1168085245 19:54041077-54041099 TCATCTATTTTCTCCAAAGACGG - Exonic
926016504 2:9457605-9457627 GCACCTATTAAGTTTAAAGAAGG + Intronic
927224963 2:20755494-20755516 TTTCCTATTTTGTTCACAGATGG + Intronic
927295764 2:21451406-21451428 ACACCTATTTGGTTTTAGGAAGG - Intergenic
927398990 2:22689071-22689093 TCACCTTTTTGTTTTAAAAAAGG - Intergenic
928439307 2:31278685-31278707 TTACAGATGTGGTTCAAAGAAGG - Intergenic
928847377 2:35693448-35693470 TCAACTATCTGATTCAAATATGG - Intergenic
931881306 2:66574147-66574169 TCACCTAAATGGCTCACAGAGGG - Intergenic
931921689 2:67023910-67023932 GCTGCCATTTGGTTCAAAGATGG + Intergenic
935072789 2:99710652-99710674 TCACCTTTTTGTGTCAAAAAAGG - Intronic
935498776 2:103812555-103812577 TCTCCTATCTGGTTCACAGTTGG + Intergenic
936465166 2:112741635-112741657 TCAGTTATTTGGTTAAAACATGG - Intronic
942701812 2:178719715-178719737 TCAGCCAAGTGGTTCAAAGATGG - Exonic
943445212 2:187976884-187976906 TCTGGTATTTGGTTCAGAGAAGG + Intergenic
943534416 2:189129601-189129623 TCACCTATTTGATTTCAAAAGGG + Intronic
948772460 2:240258648-240258670 TCCCCTATCTGGTCCAGAGAGGG + Intergenic
948966937 2:241389813-241389835 TAACTTATCTGCTTCAAAGATGG - Intronic
1170618374 20:17973342-17973364 TCAACTATTTTTTACAAAGATGG - Intronic
1171475167 20:25403023-25403045 TCAGCTGTTTGGTTCACAGCAGG + Intergenic
1173051875 20:39571326-39571348 TCAGCCATTTGGTTCACAGCAGG + Intergenic
1173473915 20:43345125-43345147 CCACCTAATTGTTTCAAAAAAGG - Intergenic
1174713233 20:52728947-52728969 TCATCTCTTTGATTCAAAGATGG - Intergenic
1174948063 20:55010696-55010718 TCACATTTCTTGTTCAAAGATGG + Intergenic
1175034550 20:55987794-55987816 TCACCTGTTTGGCTCAAACTTGG + Intergenic
1175615645 20:60396051-60396073 CCACTAATTTGTTTCAAAGAAGG - Intergenic
1178936964 21:36871384-36871406 TGAGCTATTTTGTTCAAGGAAGG + Intronic
1182065882 22:27431344-27431366 TCACCAGTTTTGTTCAAAGCAGG + Intergenic
1184153549 22:42652137-42652159 TCACCTACTGGTTTTAAAGAGGG + Intergenic
949441672 3:4087984-4088006 ACTCCTATTTGATTCTAAGAAGG + Intronic
955767948 3:62364683-62364705 TGACCTACTTTGTTCAAAAAAGG + Intergenic
957408195 3:79799863-79799885 TTACTGATTTGGTTCAAAGCTGG + Intergenic
962253017 3:133849926-133849948 TCATCTATTTGCCTCAAATAAGG + Intronic
963094756 3:141524263-141524285 TCTCCTGATTGGTTCTAAGAAGG + Intronic
964357432 3:155863479-155863501 TCCCATATTTGGTTAAAAAATGG - Intergenic
974082625 4:57228412-57228434 ACACCTATTTTGCTCAAAAATGG - Intergenic
974226815 4:59057232-59057254 TCAACTATTTGGTGAAAATAAGG + Intergenic
975433609 4:74324007-74324029 ACACCTATTTGGTGTAAAAATGG + Intergenic
977351725 4:95897274-95897296 TAACCTATGTGGTTTGAAGAGGG + Intergenic
978121566 4:105085637-105085659 CCACCTTTTTGATTCAATGAAGG - Intergenic
978401394 4:108334652-108334674 TGACTTATATGGTTAAAAGAAGG + Intergenic
979720245 4:123891402-123891424 TTACCTATATGGTTCAAAAATGG + Intergenic
980464719 4:133157862-133157884 TCACCAATGTTGTTCATAGAAGG + Intronic
980467990 4:133211064-133211086 ACAGCTATTTGGTTTAAATATGG - Intergenic
981103592 4:140856354-140856376 CCACCTTTTTGTTTCAAACAAGG + Intergenic
981571433 4:146155145-146155167 TCACCCATTTGCTTCACAGATGG - Intergenic
981585952 4:146302562-146302584 TCAGCTATATGGTTCAAAGAAGG + Intronic
989157382 5:38357059-38357081 TCTCCTTTCTGGTTCATAGATGG - Intronic
990355063 5:54958937-54958959 TCCACTATTTGGTTCACAGAAGG + Intergenic
991973488 5:72163443-72163465 TTACCTATTTGGGTCAATGATGG - Intronic
992324981 5:75651634-75651656 TCACCTATTTGGTTCAAAGAGGG + Intronic
992419614 5:76589668-76589690 CCACCTATTTTGCTGAAAGATGG - Exonic
993482521 5:88441785-88441807 TCACCTATTTTGTTACAAAAAGG - Intergenic
1000054613 5:157594002-157594024 TCACCAAGGTGGTTCAAAAAAGG + Intergenic
1008188159 6:48421315-48421337 TGCCCTATTTAGTTAAAAGAAGG - Intergenic
1014583265 6:123164123-123164145 TTACCTAGTTGGTTGTAAGATGG + Intergenic
1015154199 6:130073527-130073549 TCACCTATTTTGTTCAAATCAGG - Intronic
1021679578 7:23116409-23116431 TCACCTATTTGTGTCAAAATGGG + Intronic
1022205771 7:28162123-28162145 TCACTTATTTGGTCCAAGGCAGG + Intronic
1022247482 7:28574249-28574271 CCACATATTTGGTTCAAGGCTGG - Intronic
1024162609 7:46693020-46693042 TAACCTATTTACTTCATAGAAGG - Intronic
1024757701 7:52555474-52555496 TGAGCTATTTGATTCATAGAAGG - Intergenic
1027607020 7:80313233-80313255 TCAGCAATTTGGTTCACAGCAGG + Intergenic
1031825145 7:126555823-126555845 TCAAATGTGTGGTTCAAAGAGGG - Intronic
1033150700 7:138912715-138912737 TAACCTATCTGGGGCAAAGAGGG - Intronic
1036165279 8:6426945-6426967 TCACCTATTCGTTTCTCAGAAGG - Intronic
1038778861 8:30554089-30554111 TTAACTATTTTGTTCAAAGAGGG + Intronic
1042455907 8:69002368-69002390 TAACCTATATGGTTTAAAAATGG + Intergenic
1042491094 8:69398594-69398616 GCAACTAGTTGGTTGAAAGAAGG - Intergenic
1047501618 8:125446141-125446163 TCAAGAATTTGGGTCAAAGAAGG + Intergenic
1049027902 8:140009241-140009263 TCACTTCTGTGGTTCAAATATGG + Intronic
1052154036 9:25160145-25160167 TCAGCTATATGTTTCAAAGCAGG - Intergenic
1055000341 9:71441987-71442009 TTACCTAGTAGGCTCAAAGAGGG + Intronic
1055574788 9:77649843-77649865 TGACCTATTAGGTTTAAAGTTGG + Intergenic
1058548747 9:106090054-106090076 TCTCTTATTTGGGGCAAAGAAGG - Intergenic
1061867600 9:133501359-133501381 TCAGCTTTTTGTTTCAGAGATGG - Intergenic
1186586419 X:10878539-10878561 TCCCCTATTTGGTTCCTAGAGGG - Intergenic
1187678416 X:21741267-21741289 TTATCTGTTTTGTTCAAAGATGG + Intronic
1189712555 X:43828430-43828452 TCATCTATTTGGTTAAATCAAGG - Intronic
1190722246 X:53159305-53159327 TCAGCTGTTTGGTTCACAGCAGG + Intergenic
1191024127 X:55895112-55895134 TCTGCCATTTGGTTAAAAGATGG - Intergenic
1193874619 X:86846692-86846714 TCATTTTTTTGGTTCAAGGATGG + Intergenic
1195269770 X:103217917-103217939 TCACTTATTTGGTGCAAACTTGG + Intergenic
1196850642 X:119934903-119934925 TTACATATTTGCTTCAAATATGG - Intronic
1201224029 Y:11799683-11799705 CCTCCTGTTTGGTTTAAAGATGG + Intergenic
1201742276 Y:17336881-17336903 TCAGCCGTTTGGTTCACAGAAGG - Intergenic