ID: 992327115

View in Genome Browser
Species Human (GRCh38)
Location 5:75671134-75671156
Sequence CTATGATGATGGTGGTGACA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 260}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992327111_992327115 13 Left 992327111 5:75671098-75671120 CCATAAATTTCTTCTAGCAGTAG 0: 1
1: 0
2: 0
3: 20
4: 217
Right 992327115 5:75671134-75671156 CTATGATGATGGTGGTGACAGGG 0: 1
1: 0
2: 3
3: 34
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992327115 Original CRISPR CTATGATGATGGTGGTGACA GGG Exonic
900388094 1:2419723-2419745 CTCTGGTGGAGGTGGTGACATGG + Intergenic
900505067 1:3025909-3025931 TGATGATGATGGTAATGACATGG + Intergenic
900945612 1:5829864-5829886 TGATGGTGATGATGGTGACAGGG + Intergenic
901607171 1:10468220-10468242 CTGTGATGATGATGATGGCAGGG + Intronic
902958736 1:19946059-19946081 ACATGATGATGGTGGTGATAAGG - Intergenic
903246924 1:22022983-22023005 CTGGGGTCATGGTGGTGACAGGG + Intergenic
903362225 1:22783874-22783896 CTAGGATGATGGGGAAGACAGGG - Intronic
903852834 1:26318477-26318499 CTGTGGTTATGGAGGTGACAGGG + Intronic
904488379 1:30842843-30842865 GATTGATGATGGTGGTGACAAGG - Intergenic
906845323 1:49185476-49185498 CTATTCTGAGGGTGGTGAAAGGG - Intronic
906889363 1:49691357-49691379 CCATGATGATGTTGCTGACCTGG + Intronic
907517672 1:55003079-55003101 TGATGATGATGGTGCTGACTGGG + Intronic
908665731 1:66488003-66488025 CTATCATCATGGTGGGGACCTGG - Intergenic
909781969 1:79558854-79558876 CTGTGGTGGTGGTGGTCACATGG + Intergenic
909981072 1:82101908-82101930 CTATGATGAAGTTGGAGAAATGG - Intergenic
910481735 1:87665653-87665675 CTACTATGATGGTTGTGAAATGG + Intergenic
911858475 1:102913663-102913685 AGATGGTGTTGGTGGTGACAAGG - Exonic
914957259 1:152174042-152174064 CACTGCTGATGGTGATGACAAGG + Intergenic
915083788 1:153370573-153370595 TGGTGATAATGGTGGTGACAAGG + Intergenic
915635487 1:157183651-157183673 CTAAAATGAAGGTGGTGGCAGGG + Intergenic
915648558 1:157291167-157291189 CTAAAATGAAGGTGGTGGCAGGG - Intergenic
915662132 1:157413347-157413369 CTAAAATGAAGGTGGTGGCAGGG + Intergenic
918114528 1:181484903-181484925 CTCTGATGGTGGTGGTGTCAGGG + Intronic
918596821 1:186304117-186304139 CTTTGAAGATGGTGGTGATGTGG - Exonic
919826113 1:201504712-201504734 CTGAGATGGTGGTGGGGACAGGG + Intronic
921597253 1:217067987-217068009 CTAAGATGATGTTACTGACAGGG + Intronic
921631059 1:217434395-217434417 CCATGATTATGGTGGTAACCAGG + Intronic
1064094126 10:12410226-12410248 ACAAGATGATGGTGGTTACAAGG + Intronic
1065083652 10:22152295-22152317 TGATGATGATGATGATGACAAGG + Intergenic
1066584343 10:36915446-36915468 ATAAGATGATGATGATGACAGGG - Intergenic
1067070695 10:43128966-43128988 CTATGTGGATGGTGGTATCAGGG + Exonic
1067571073 10:47371529-47371551 CTATGATGATGCTAGTATCATGG + Intronic
1069277606 10:66612120-66612142 TTGTGATGATGGAGGTGAAAGGG - Intronic
1069999561 10:72366231-72366253 CTATGATGTTGGCCGTGCCAAGG + Intergenic
1070553764 10:77512795-77512817 CCAAGATCATGGTGTTGACAGGG - Intronic
1070952982 10:80445680-80445702 CTAAGCAGATGGTGGTGACAAGG - Intergenic
1071188741 10:83076590-83076612 ATGTGATGATGGTAGTCACAGGG - Intergenic
1071751142 10:88477520-88477542 TTGTGATGATGGTGAAGACAGGG + Intronic
1071751148 10:88477573-88477595 CAAGGATGATAGTGATGACAGGG + Intronic
1075301907 10:121332514-121332536 ATATGATGATGGTGGTGATGAGG + Intergenic
1075922809 10:126227074-126227096 TAGTGATGGTGGTGGTGACAGGG - Intronic
1075936869 10:126350516-126350538 CTAGAATGATGGAGTTGACAGGG - Intronic
1076677550 10:132155122-132155144 TGATGGTGATGGTGGTGATATGG + Intronic
1077175583 11:1188606-1188628 CTGTGCTGGTGGTGGTAACAGGG - Intronic
1079284116 11:19114003-19114025 CTGAGATGAAGGTGTTGACAGGG - Intergenic
1080290671 11:30667444-30667466 CTAGGGTGATGGTGGTGAGATGG + Intergenic
1081460879 11:43272019-43272041 TGATGATGATGATGATGACAGGG + Intergenic
1082314064 11:50695425-50695447 CTATGATGATGGTGATGTACAGG - Intergenic
1083177460 11:60960086-60960108 CTAAAATGAAGGTGTTGACAGGG - Intergenic
1083791464 11:64988939-64988961 ATAAGATATTGGTGGTGACAGGG + Exonic
1084346876 11:68558217-68558239 CTCTGATGATGATGATGACTGGG - Intronic
1084770855 11:71342056-71342078 CTTTGAGGAAGGGGGTGACATGG + Intergenic
1086396223 11:86418173-86418195 CTATCCTGATGGATGTGACATGG - Intronic
1088154798 11:106790258-106790280 CTATGGTGGTGGTGGCCACAGGG - Intronic
1090059157 11:123448815-123448837 CTATGGTGATGGAGCTGAGAAGG - Intergenic
1091815165 12:3432169-3432191 CTGAGATGATGGTGATGGCAGGG + Intronic
1092563956 12:9645597-9645619 CTATGATGATGATGTTAGCAGGG + Intergenic
1093428619 12:19057760-19057782 CGTTGATGCTGATGGTGACAAGG - Intergenic
1096428231 12:51522094-51522116 CTAGGCTGATGGTTGTCACATGG + Intergenic
1098768926 12:74527477-74527499 CTCTAATGATGATGGTGAAATGG - Intergenic
1099750892 12:86771187-86771209 CTGAGATCATGGTGGTGACAGGG - Intronic
1102171860 12:110848365-110848387 CTATGAGGATGGGGGTGAGGGGG + Intronic
1103863826 12:124035502-124035524 GTGTGATGATGATGGTGCCATGG - Intronic
1104484329 12:129136914-129136936 TGATGATGATGGTGGTGGTATGG - Intronic
1106752417 13:32788638-32788660 CAATGATGATGGTGGGTAGAAGG - Intergenic
1106767252 13:32925628-32925650 CGATTATGGTGGTGGTTACATGG - Intergenic
1107725267 13:43292860-43292882 CTGTGATGAAGATGGTGACTGGG - Intronic
1107988663 13:45797914-45797936 CTTTCATGATGGCGGTGATAGGG + Intronic
1108682286 13:52790549-52790571 CAATGGTGAAGGTGGAGACAAGG - Intergenic
1109435641 13:62296773-62296795 TGATGATGATGGTGGTGGCAGGG + Intergenic
1111956397 13:94763440-94763462 CTATGATGGTGTTGATGGCAAGG + Intergenic
1112855904 13:103769104-103769126 CCAAGATGCTGATGGTGACATGG - Intergenic
1113003543 13:105672271-105672293 AAATGGTGATGGTGGTGTCATGG + Intergenic
1113504784 13:110807877-110807899 CAATGAGGATGATGGTGCCAGGG + Intergenic
1115148742 14:30258471-30258493 TAATGATGATGGTGGTGATTTGG + Intergenic
1115302524 14:31900645-31900667 CTATGATGTTGGCAGTGACATGG - Intergenic
1120697498 14:87660059-87660081 CTGTGGTGGTGGTGGTCACAAGG + Intergenic
1122269582 14:100562561-100562583 GTCTGCTGATGGGGGTGACATGG - Intronic
1122412191 14:101531337-101531359 CAATGATGCTGGTGTTGACTGGG + Intergenic
1123508593 15:20972120-20972142 CTGTGATGGTGGTGGCCACAGGG - Intergenic
1123565814 15:21545869-21545891 CTGTGATGGTGGTGGCCACAGGG - Intergenic
1123602076 15:21983156-21983178 CTGTGATGGTGGTGGCCACAGGG - Intergenic
1126372579 15:47962817-47962839 CCATGTTGAGGGTGGTGAGAGGG + Intergenic
1126748808 15:51854471-51854493 CTATGGAAATGGTGGTGAAATGG + Intronic
1127935828 15:63636632-63636654 CTAAAATAATGGTGATGACAAGG + Intronic
1129113743 15:73353417-73353439 CAATGATGAAGGTGGAGAGAGGG + Intronic
1130356673 15:83138920-83138942 GTTTGATGATGGTGGGGTCAAGG + Exonic
1130978758 15:88797835-88797857 TTGTGATGATGGTGGTGGGATGG + Intergenic
1131242727 15:90761053-90761075 CTTTGATGATGATGATGACTGGG + Exonic
1202974183 15_KI270727v1_random:272962-272984 CTGTGATGGTGGTGGCCACAGGG - Intergenic
1133815139 16:9191372-9191394 TGATGATGATGGTGATGATATGG + Intergenic
1133815143 16:9191428-9191450 TAATGATGATGGTGATGATATGG + Intergenic
1133840232 16:9401535-9401557 TGGTGATGATGGAGGTGACAAGG - Intergenic
1134146925 16:11772629-11772651 GTAGGATGATGGTGATGATAGGG - Intronic
1134356948 16:13491256-13491278 CGATGATGATGATGGTAACGAGG + Intergenic
1139300073 16:65937504-65937526 CCAAGATGAAGGTGTTGACAGGG + Intergenic
1139592308 16:67940113-67940135 CTATGAGGATGGTGATGACACGG - Exonic
1141492722 16:84385447-84385469 GAATGATGATGATGGTGATATGG - Intronic
1141735768 16:85851575-85851597 AGATGATGATGGTGGTGATGGGG - Intergenic
1142261794 16:89046110-89046132 TAATGATGATGGTGATGATAGGG - Intergenic
1142503003 17:344032-344054 CGATGATGATGGTGATGATGGGG - Intronic
1142562682 17:820131-820153 CTGTGATGATGGTGGTTACGTGG + Intronic
1142562688 17:820201-820223 CTGTGATGATGGTGGTAACATGG + Intronic
1143644249 17:8219737-8219759 CTGTGTGGATGGTGGTGAGATGG + Intergenic
1144292201 17:13837567-13837589 CTTTGATGATGGAGATGGCACGG - Intergenic
1145109666 17:20151547-20151569 CTCTGATGATCATGGTGACAGGG - Intronic
1145415754 17:22712495-22712517 GTATGGTGATGGTGATGATAAGG + Intergenic
1146063452 17:29618708-29618730 CTCTGATAATGGTGGGTACAAGG + Intronic
1146135121 17:30313337-30313359 TCATGATGGTGGTGATGACAGGG + Intergenic
1146820825 17:35982645-35982667 CTCTGTTTATGGAGGTGACAAGG + Intergenic
1147645607 17:42031915-42031937 CTATGGTGATGATGATGACAAGG - Intronic
1148281983 17:46355299-46355321 CTATAATGATGGTAGGGGCAGGG + Intronic
1148304201 17:46573222-46573244 CTATAATGATGGTAGGGGCAGGG + Intronic
1148564979 17:48627328-48627350 TTAAGATGGTGGTGGTGACGTGG + Intronic
1150287858 17:63963980-63964002 CCATGGTGGTGGGGGTGACAGGG + Intronic
1151419061 17:73985558-73985580 CTGTGAGGATGGGGGTCACATGG + Intergenic
1152026079 17:77810245-77810267 CGATGATGGTGGTGGTAACGGGG + Intergenic
1152756016 17:82087376-82087398 CGATGTGGATGGCGGTGACACGG + Exonic
1153113257 18:1619971-1619993 GTACGGTGATGGTGGTGATAGGG - Intergenic
1154386633 18:13898252-13898274 CTTTGGTGATGTTGGTTACAGGG + Intronic
1155714489 18:28924408-28924430 CAATGATGATGCTGAAGACAAGG - Intergenic
1156078076 18:33304782-33304804 CTATCATGGTGCTGGTGAGAGGG - Intronic
1156396619 18:36705103-36705125 CTGTGATGCAGGTGGAGACAGGG + Intronic
1157945769 18:51979075-51979097 CCATGATGATTGGAGTGACACGG - Intergenic
1158949926 18:62484761-62484783 ATTTGATGATGGTGTTGAGAAGG + Intergenic
1159755442 18:72358397-72358419 TTATGATGATGGTGGTAAATTGG - Intergenic
1161607052 19:5220951-5220973 GTAGGCTGATGGGGGTGACAAGG + Intronic
1161843744 19:6697955-6697977 AGATGATGATGGTGGTGGCTGGG + Intronic
1161861395 19:6801043-6801065 TGATGATGAGGGTGGTGAGAGGG - Intronic
1162182717 19:8881622-8881644 TAATGATGGTGATGGTGACAGGG - Intronic
1162183586 19:8887665-8887687 TGATGATGATGGTGGTGGCAGGG - Intronic
1162186733 19:8910897-8910919 CAATGATGATGATGGTGATAAGG - Intronic
1162424187 19:10584091-10584113 CTTGGATGCTGGTGGTGACCAGG - Intronic
1162899807 19:13788000-13788022 CTCAGATGAAGGTGGAGACAAGG - Intergenic
1163013683 19:14440917-14440939 CTGTGGTGGTGGGGGTGACAAGG + Intronic
1165617761 19:37217295-37217317 TGATTACGATGGTGGTGACAAGG + Intronic
925047637 2:786110-786132 CTAAGATGAAGGTGTTGGCAGGG - Intergenic
925728372 2:6896799-6896821 ATTTGATGATGGAGTTGACATGG + Exonic
926822510 2:16868085-16868107 CGATGATGATGACAGTGACAAGG - Intergenic
926966673 2:18422539-18422561 CTGAGATGATGCTGGTGACTAGG + Intergenic
927087821 2:19688774-19688796 CTAAGATGAAGGTGTTGGCAGGG - Intergenic
928661325 2:33505124-33505146 TGATGATGATGGTGATGATATGG - Intronic
929162264 2:38844185-38844207 CTATGGTGACGGTGGTGGTATGG + Intronic
930133475 2:47877490-47877512 CTCTGATGAAGGTGTTGACTTGG + Intronic
930806968 2:55500512-55500534 CTAAAATGAAGGTGTTGACATGG + Intergenic
931654810 2:64501366-64501388 CTATGAGGATGGGGGTGCTATGG + Intergenic
932273471 2:70432350-70432372 CTGTGATGTTGGTGCTAACATGG - Intergenic
935145092 2:100390239-100390261 CTGTGATGATTGGGGTGATAGGG - Intergenic
936091861 2:109506776-109506798 CTAAAATGATGGTTCTGACAGGG + Intergenic
937425670 2:121796571-121796593 CTAGGATCAAGGTGGTGGCAAGG + Intergenic
937814145 2:126232465-126232487 CTTTGTTGATGGTGGTTACTGGG + Intergenic
937825555 2:126365148-126365170 CCAGGTTGATGGTGGTGACTGGG + Intergenic
938229759 2:129648340-129648362 TGATGATGATGTTGATGACATGG - Intergenic
939175215 2:138740171-138740193 CTATGATGATGGAGTAGAAAAGG + Intronic
939366653 2:141241798-141241820 CTATGCTGGTGCTGGTGACTAGG + Intronic
941098761 2:161273934-161273956 CTTTGATGAGGGTGGTTACATGG + Intergenic
945184978 2:207131168-207131190 TGATGATGATGGTGGTGAGAAGG + Intronic
945594751 2:211777644-211777666 CTATAATGGTTGGGGTGACAAGG - Intronic
945698361 2:213138232-213138254 AGATGATGATGGTGGTGTCATGG + Intronic
946151127 2:217771770-217771792 CTATGAAAATGGTGGGGAAATGG - Intergenic
947369315 2:229428296-229428318 CTGGGATGAGAGTGGTGACAGGG + Intronic
947383202 2:229564638-229564660 TGATGATGATGGTGGTGATGGGG - Intronic
947383207 2:229564661-229564683 TGATGATGATGATGGTGACGGGG - Intronic
947627895 2:231632460-231632482 CTACAATGAAGGTGTTGACAGGG - Intergenic
947731333 2:232433180-232433202 GCAGGATGATGGTAGTGACAAGG + Intergenic
1170797759 20:19564458-19564480 ATATGATGATGGTGGAGACAAGG - Intronic
1171066420 20:22020482-22020504 CTATGCTAATGCTGTTGACATGG - Intergenic
1171260190 20:23725175-23725197 TAATGGTGATGGTGGTGATAAGG - Intergenic
1171446745 20:25209904-25209926 CTATGCTGATGATGTTGAAAAGG + Exonic
1174767729 20:53269571-53269593 ATATGATGATGGTGATGAGGAGG + Intronic
1175812489 20:61866021-61866043 CCAGGATGCTGGTGGTGACAGGG - Intronic
1175993847 20:62803675-62803697 CTGTAATGATGGTGGTGGAAAGG - Intergenic
1176350746 21:5794184-5794206 GGGTGATGATGGGGGTGACAGGG + Intergenic
1176357560 21:5914768-5914790 GGGTGATGATGGGGGTGACAGGG + Intergenic
1176545067 21:8192254-8192276 GGGTGATGATGGGGGTGACAGGG + Intergenic
1176564018 21:8375299-8375321 GGGTGATGATGGGGGTGACAGGG + Intergenic
1178604727 21:34025763-34025785 CTAAAATCATGGTGTTGACAAGG - Intergenic
1178817112 21:35941694-35941716 CTATGATGAGGGTGGTAATCAGG + Intronic
1179959826 21:44761979-44762001 CAACGATGTGGGTGGTGACAGGG - Intergenic
1181771528 22:25129138-25129160 CCATGAGGATGGTGGCGGCATGG + Intronic
1182465578 22:30514214-30514236 CTGTGATGATGGTGCTCTCATGG + Intergenic
1182791099 22:32953758-32953780 AGATGATGATGTTGGTGATAAGG - Intronic
1183092701 22:35533878-35533900 TGATGATGATGGTGATGACGGGG + Intergenic
1183305869 22:37082808-37082830 CTATGCTGTTGGGGGTAACATGG - Intronic
1184273645 22:43398589-43398611 CTAGGATGATGGTGATAAGAAGG - Intergenic
1185003423 22:48261009-48261031 TGATGATGATGGTGATGAAAAGG - Intergenic
1185060758 22:48605466-48605488 TGATGATGTTGGTGGTGGCAGGG + Intronic
1185215267 22:49595669-49595691 TGGTGATGATGGTGGTGATATGG + Intronic
1203249937 22_KI270733v1_random:108492-108514 GGGTGATGATGGGGGTGACAGGG + Intergenic
949253205 3:2012871-2012893 TGATGATGATGGTGGTGATAAGG - Intergenic
949407241 3:3727340-3727362 TTAGGATGATGATGGTGGCATGG + Intronic
950252526 3:11478456-11478478 CTATGATGATGTGGCTGTCATGG + Intronic
951160669 3:19417053-19417075 CTATGGTGGTGGTGCTGACAGGG - Intronic
951786388 3:26424191-26424213 CTATGTAGACGGTGGAGACAAGG - Intergenic
951822499 3:26827837-26827859 CAATGCTGCTGGTGGGGACAGGG - Intergenic
952005131 3:28834975-28834997 GTATGAAGAGGGTGGTAACAAGG - Intergenic
953646810 3:44763100-44763122 TTATGATGGTGGTGATGCCATGG + Intronic
954381420 3:50221077-50221099 CTGGGATGAGGGTGGGGACAGGG + Intergenic
954827371 3:53385880-53385902 AGAAGATGGTGGTGGTGACAAGG - Intergenic
956128939 3:66037314-66037336 CGATGATGGTGGTGGTGGGAGGG + Intronic
957792733 3:84960114-84960136 ATATGATGATGGTGGGAAGAGGG - Intronic
958103476 3:89044247-89044269 TTATGATGATTCTGGTGATATGG + Intergenic
958428242 3:94005329-94005351 CTATGGTGGTAGTGATGACAAGG + Intronic
960052559 3:113252348-113252370 TGATGATGATGATGGTGACATGG - Intronic
960298023 3:115967960-115967982 CTAGGATGGTGGTGGTCACAGGG - Intronic
960302332 3:116018773-116018795 TTATGGCGATGGTGGTGAGAAGG + Intronic
960873679 3:122275868-122275890 CTTTGATGAGTGTGGTGACCTGG + Exonic
961399174 3:126623002-126623024 CTAAGATCAAGGTGTTGACAGGG - Intronic
961667502 3:128502878-128502900 CTGGGATGATGGTGGAGACCTGG + Intergenic
961836552 3:129665943-129665965 ATTTGATGATGATGGTGACAAGG - Intronic
961838049 3:129681024-129681046 ATATGATGATGGTAGTGATACGG + Intronic
963051222 3:141145746-141145768 AGATGATGATGGTGGTCACATGG - Intronic
965927620 3:174001747-174001769 TGATGATGGTGGTGGTGACAAGG + Intronic
966058258 3:175723461-175723483 TTTTGGTGATGGTGGTAACATGG + Intronic
969529802 4:7724364-7724386 TGGTGATGATGGTGGTGATAGGG + Intronic
969996158 4:11315493-11315515 CTTGGATGAAGGTGGTGGCAAGG - Intergenic
971348731 4:25837125-25837147 CTATGACGGGGGTGGTGAGAGGG + Intronic
982274282 4:153623266-153623288 CAATGATGATGATTATGACAAGG - Intronic
982776147 4:159443574-159443596 CTATGATGATGGTTGTTTAATGG - Intergenic
982979569 4:162115592-162115614 CTGTGAAGATGGAGGTTACAAGG - Intronic
987823156 5:22991742-22991764 CTGTGGTGATGGTGGCTACAGGG + Intergenic
988503023 5:31799216-31799238 CTCTGATGATGCTGGTGTCTGGG + Exonic
988696367 5:33626317-33626339 CAGTGATGATGGTGGTGATGTGG + Intronic
991115040 5:62945538-62945560 AGATGACTATGGTGGTGACATGG - Intergenic
992178726 5:74175932-74175954 CTAGGAAGAAGATGGTGACAGGG - Intergenic
992327115 5:75671134-75671156 CTATGATGATGGTGGTGACAGGG + Exonic
992993858 5:82313391-82313413 CTAAGATTCTGGTGGTGAAAAGG - Intronic
993084280 5:83343968-83343990 CTATTGTGAAGATGGTGACATGG - Intronic
994233926 5:97339764-97339786 CTGTGATGGTGGTGGTCACAGGG + Intergenic
994477526 5:100290128-100290150 TCATAATGGTGGTGGTGACAGGG - Intergenic
995850368 5:116538790-116538812 TGATGATGGTGATGGTGACAAGG - Intronic
996016474 5:118544490-118544512 TAATGATGATGGTGGTGGTAAGG - Intergenic
996299441 5:121963481-121963503 CTTTGATGATGGAAATGACAGGG + Intronic
998975019 5:147636048-147636070 TGATGGTGATGGCGGTGACAGGG + Intronic
999190870 5:149746306-149746328 CTATGATTTTGGTTGTGACATGG + Intronic
999496227 5:152101051-152101073 CTATGATGGTGGGGGTGTCGGGG - Intergenic
1000699735 5:164433862-164433884 CTATGGTGATGGTGCTGATGGGG + Intergenic
1002820587 6:720738-720760 CCAGGAGGACGGTGGTGACATGG + Intergenic
1002866958 6:1130258-1130280 CTGTGATGATGGTGGAGTAAAGG - Intergenic
1003430836 6:6035995-6036017 TGATGATGATGATGGTGATACGG - Intergenic
1006303497 6:33206352-33206374 CTATGAGAATGGTGGGGAGAGGG - Intronic
1007748102 6:44055561-44055583 CTCTGCTGTTGCTGGTGACAGGG - Intergenic
1007808446 6:44469230-44469252 CAGTGATGATGGTGATGATATGG + Intergenic
1008985182 6:57533919-57533941 CTATGATGATGATCCTGTCATGG + Intronic
1009173218 6:60426874-60426896 CTATGATGATGATCTTGTCATGG + Intergenic
1016469945 6:144364720-144364742 CTAAAATGAAGGTGTTGACAGGG + Intronic
1017720176 6:157238350-157238372 TTATGGTGATGGTGGTGATGAGG + Intergenic
1018840923 6:167515971-167515993 TGATGATGATGGTGGTGATAAGG - Intergenic
1019765974 7:2850623-2850645 TGATAATGATGGTGGTGATAGGG - Intergenic
1019824262 7:3270478-3270500 TGATGATGATGGTGGTGATAAGG + Intergenic
1020878221 7:13725347-13725369 CTACGATGTTGCTGGTGTCATGG - Intergenic
1021409432 7:20313013-20313035 AGATGATGGTGATGGTGACATGG + Intergenic
1022510858 7:30934018-30934040 CTATGATGATGCAGGTGTCGGGG - Intergenic
1022740131 7:33112604-33112626 CTATGTTGATGGGGGTGAGGAGG + Intergenic
1022779465 7:33564228-33564250 CTATGGTGATGAGGGTGCCATGG - Intronic
1022849393 7:34244749-34244771 CTTTGATTATGGTGGTGCAATGG - Intergenic
1023681774 7:42694802-42694824 CTATGGTGATGGTGGGGATCTGG - Intergenic
1024841430 7:53591449-53591471 CTATGCTGATAGTAGTGATATGG - Intergenic
1025282294 7:57636954-57636976 TGATGATGATGGTGCTGACTGGG + Intergenic
1025302436 7:57828565-57828587 TGATGATGATGGTGCTGACTGGG - Intergenic
1027648190 7:80831403-80831425 CTATACTGATGCTGGTTACATGG + Intronic
1029732378 7:102446878-102446900 CCATGATGATGGTGGACACCAGG - Exonic
1031084580 7:117289907-117289929 CCGGGATGATGGAGGTGACAAGG + Intronic
1031478377 7:122249454-122249476 TTAAGATGAAGGTGCTGACAGGG - Intergenic
1032413979 7:131722165-131722187 CTCTGATGCTGGAGGGGACATGG + Intergenic
1033204346 7:139404650-139404672 CTAGGATGATGATGGTGATGAGG + Intronic
1034291234 7:149933254-149933276 CTATGGGGATGGTGGGGAGATGG - Intergenic
1034370000 7:150586703-150586725 CTATTATGATGGTGGAAACTAGG - Intergenic
1034590460 7:152133909-152133931 CTAGGCGGATGGTCGTGACATGG - Intergenic
1034707331 7:153157252-153157274 CTACAATGAGGGTGGTGATATGG - Intergenic
1034814864 7:154163677-154163699 CTATGGGGATGGTGGGGAGATGG + Intronic
1034999934 7:155604399-155604421 CTCTGAGGATGGAGGTGAGAGGG + Intergenic
1035323357 7:158048899-158048921 TGATGGTGATGGTGGTGATATGG - Intronic
1037025763 8:14035141-14035163 CTATGAATATGTTGGTGATATGG - Intergenic
1037284083 8:17277655-17277677 GTATGATGATGATGGTGACTGGG - Intronic
1037689287 8:21169315-21169337 CCGTGATGATGTTGATGACAAGG - Intergenic
1038380554 8:27089181-27089203 ATATTATCATGTTGGTGACATGG + Intergenic
1039797802 8:40930179-40930201 TTATGATGATGGTGGTGGCTGGG + Intergenic
1042115385 8:65426081-65426103 CTGAGATGAAGGTGCTGACAGGG - Intergenic
1042432031 8:68717851-68717873 CTATTATAATGGTGATGACATGG + Intronic
1048007168 8:130428765-130428787 ATATGATGATGGTGGTAATGGGG - Intronic
1048365587 8:133735608-133735630 ATAAGAGGATGGTGGTGATAAGG + Intergenic
1048434281 8:134401558-134401580 CGATGATGATGATGTTGATAAGG - Intergenic
1049417655 8:142502765-142502787 TTATGATGTTGATGGTGTCATGG + Intronic
1049698739 8:143996939-143996961 CTATGGTGATGGTGCAGGCAGGG + Intronic
1058922192 9:109627742-109627764 AAATGATGGGGGTGGTGACAAGG - Intergenic
1059423676 9:114207676-114207698 ATATGAGGCTGGTGGTGGCAGGG - Intronic
1060443954 9:123670360-123670382 TTCTGATGAAGGTGGTGACAAGG + Intronic
1203466333 Un_GL000220v1:91753-91775 GGGTGATGATGGGGGTGACAGGG + Intergenic
1185444848 X:252434-252456 CTTGGATGTTGGTGGGGACAAGG + Intergenic
1186358945 X:8818684-8818706 TGACGATGATGGTGATGACAAGG - Intergenic
1186694717 X:12018190-12018212 CTAAGATAAAGGTGTTGACAAGG + Intergenic
1188422205 X:30003869-30003891 GTATTATGGTGGTGGGGACAGGG - Intergenic
1188605247 X:32020649-32020671 CTAAGATTAAGGTGATGACAGGG - Intronic
1188755368 X:33954898-33954920 CTATGATCAAGGTGTTGGCAAGG + Intergenic
1188945376 X:36294224-36294246 TTATGATCATGGTGCTGACGTGG - Intronic
1188972262 X:36632570-36632592 CTGTGGTGATGGTGGACACAAGG - Intergenic
1194088177 X:89554518-89554540 CTCTGATGATGATGATGAGATGG + Intergenic