ID: 992331853

View in Genome Browser
Species Human (GRCh38)
Location 5:75725189-75725211
Sequence CAAGATGGAGACTATGACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992331853_992331856 -8 Left 992331853 5:75725189-75725211 CCCAGGTCATAGTCTCCATCTTG No data
Right 992331856 5:75725204-75725226 CCATCTTGTAGCTCACCAGTTGG No data
992331853_992331857 -7 Left 992331853 5:75725189-75725211 CCCAGGTCATAGTCTCCATCTTG No data
Right 992331857 5:75725205-75725227 CATCTTGTAGCTCACCAGTTGGG No data
992331853_992331860 17 Left 992331853 5:75725189-75725211 CCCAGGTCATAGTCTCCATCTTG No data
Right 992331860 5:75725229-75725251 TCTATTTTAAGTCTGATTAATGG No data
992331853_992331858 -6 Left 992331853 5:75725189-75725211 CCCAGGTCATAGTCTCCATCTTG No data
Right 992331858 5:75725206-75725228 ATCTTGTAGCTCACCAGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992331853 Original CRISPR CAAGATGGAGACTATGACCT GGG (reversed) Intergenic
No off target data available for this crispr