ID: 992331856

View in Genome Browser
Species Human (GRCh38)
Location 5:75725204-75725226
Sequence CCATCTTGTAGCTCACCAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992331854_992331856 -9 Left 992331854 5:75725190-75725212 CCAGGTCATAGTCTCCATCTTGT No data
Right 992331856 5:75725204-75725226 CCATCTTGTAGCTCACCAGTTGG No data
992331853_992331856 -8 Left 992331853 5:75725189-75725211 CCCAGGTCATAGTCTCCATCTTG No data
Right 992331856 5:75725204-75725226 CCATCTTGTAGCTCACCAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992331856 Original CRISPR CCATCTTGTAGCTCACCAGT TGG Intergenic
No off target data available for this crispr