ID: 992331858

View in Genome Browser
Species Human (GRCh38)
Location 5:75725206-75725228
Sequence ATCTTGTAGCTCACCAGTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992331853_992331858 -6 Left 992331853 5:75725189-75725211 CCCAGGTCATAGTCTCCATCTTG No data
Right 992331858 5:75725206-75725228 ATCTTGTAGCTCACCAGTTGGGG No data
992331854_992331858 -7 Left 992331854 5:75725190-75725212 CCAGGTCATAGTCTCCATCTTGT No data
Right 992331858 5:75725206-75725228 ATCTTGTAGCTCACCAGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992331858 Original CRISPR ATCTTGTAGCTCACCAGTTG GGG Intergenic
No off target data available for this crispr