ID: 992331860

View in Genome Browser
Species Human (GRCh38)
Location 5:75725229-75725251
Sequence TCTATTTTAAGTCTGATTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992331855_992331860 2 Left 992331855 5:75725204-75725226 CCATCTTGTAGCTCACCAGTTGG No data
Right 992331860 5:75725229-75725251 TCTATTTTAAGTCTGATTAATGG No data
992331854_992331860 16 Left 992331854 5:75725190-75725212 CCAGGTCATAGTCTCCATCTTGT No data
Right 992331860 5:75725229-75725251 TCTATTTTAAGTCTGATTAATGG No data
992331853_992331860 17 Left 992331853 5:75725189-75725211 CCCAGGTCATAGTCTCCATCTTG No data
Right 992331860 5:75725229-75725251 TCTATTTTAAGTCTGATTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992331860 Original CRISPR TCTATTTTAAGTCTGATTAA TGG Intergenic
No off target data available for this crispr