ID: 992335338

View in Genome Browser
Species Human (GRCh38)
Location 5:75761828-75761850
Sequence CTGTAGTTACAGAGGTAATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992335338_992335341 -8 Left 992335338 5:75761828-75761850 CCCTATTACCTCTGTAACTACAG No data
Right 992335341 5:75761843-75761865 AACTACAGTTAGAACTAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992335338 Original CRISPR CTGTAGTTACAGAGGTAATA GGG (reversed) Intergenic
No off target data available for this crispr