ID: 992336713

View in Genome Browser
Species Human (GRCh38)
Location 5:75777901-75777923
Sequence CCAGGAACGCTCTATAAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992336713_992336716 -10 Left 992336713 5:75777901-75777923 CCATCTTTATAGAGCGTTCCTGG No data
Right 992336716 5:75777914-75777936 GCGTTCCTGGGAGCTCCACCCGG No data
992336713_992336721 14 Left 992336713 5:75777901-75777923 CCATCTTTATAGAGCGTTCCTGG No data
Right 992336721 5:75777938-75777960 GACTTGTGCTTTCATCTCGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992336713 Original CRISPR CCAGGAACGCTCTATAAAGA TGG (reversed) Intergenic