ID: 992336716

View in Genome Browser
Species Human (GRCh38)
Location 5:75777914-75777936
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992336713_992336716 -10 Left 992336713 5:75777901-75777923 CCATCTTTATAGAGCGTTCCTGG No data
Right 992336716 5:75777914-75777936 GCGTTCCTGGGAGCTCCACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type