ID: 992336721

View in Genome Browser
Species Human (GRCh38)
Location 5:75777938-75777960
Sequence GACTTGTGCTTTCATCTCGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992336713_992336721 14 Left 992336713 5:75777901-75777923 CCATCTTTATAGAGCGTTCCTGG No data
Right 992336721 5:75777938-75777960 GACTTGTGCTTTCATCTCGTTGG No data
992336717_992336721 -4 Left 992336717 5:75777919-75777941 CCTGGGAGCTCCACCCGGTGACT No data
Right 992336721 5:75777938-75777960 GACTTGTGCTTTCATCTCGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992336721 Original CRISPR GACTTGTGCTTTCATCTCGT TGG Intergenic
No off target data available for this crispr