ID: 992338853

View in Genome Browser
Species Human (GRCh38)
Location 5:75800902-75800924
Sequence GAAACAAGGTTGTTTCTCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992338847_992338853 -4 Left 992338847 5:75800883-75800905 CCTCCCGCAGATACCTAAGGAAA No data
Right 992338853 5:75800902-75800924 GAAACAAGGTTGTTTCTCAAGGG No data
992338848_992338853 -7 Left 992338848 5:75800886-75800908 CCCGCAGATACCTAAGGAAACAA No data
Right 992338853 5:75800902-75800924 GAAACAAGGTTGTTTCTCAAGGG No data
992338844_992338853 25 Left 992338844 5:75800854-75800876 CCAAGCTAAGTCCAACTCAGTAG No data
Right 992338853 5:75800902-75800924 GAAACAAGGTTGTTTCTCAAGGG No data
992338849_992338853 -8 Left 992338849 5:75800887-75800909 CCGCAGATACCTAAGGAAACAAG No data
Right 992338853 5:75800902-75800924 GAAACAAGGTTGTTTCTCAAGGG No data
992338845_992338853 14 Left 992338845 5:75800865-75800887 CCAACTCAGTAGCTCTTTCCTCC No data
Right 992338853 5:75800902-75800924 GAAACAAGGTTGTTTCTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992338853 Original CRISPR GAAACAAGGTTGTTTCTCAA GGG Intergenic
No off target data available for this crispr