ID: 992339966

View in Genome Browser
Species Human (GRCh38)
Location 5:75813807-75813829
Sequence GCTAATCCTGGAAGCAACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992339966_992339968 8 Left 992339966 5:75813807-75813829 CCTCTGTTGCTTCCAGGATTAGC No data
Right 992339968 5:75813838-75813860 TAACATTCTGAATCTTTTTCAGG No data
992339966_992339969 17 Left 992339966 5:75813807-75813829 CCTCTGTTGCTTCCAGGATTAGC No data
Right 992339969 5:75813847-75813869 GAATCTTTTTCAGGTAAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992339966 Original CRISPR GCTAATCCTGGAAGCAACAG AGG (reversed) Intergenic
No off target data available for this crispr