ID: 992339968

View in Genome Browser
Species Human (GRCh38)
Location 5:75813838-75813860
Sequence TAACATTCTGAATCTTTTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992339966_992339968 8 Left 992339966 5:75813807-75813829 CCTCTGTTGCTTCCAGGATTAGC No data
Right 992339968 5:75813838-75813860 TAACATTCTGAATCTTTTTCAGG No data
992339963_992339968 29 Left 992339963 5:75813786-75813808 CCTTAGATTGAGCTTCACCTTCC No data
Right 992339968 5:75813838-75813860 TAACATTCTGAATCTTTTTCAGG No data
992339965_992339968 12 Left 992339965 5:75813803-75813825 CCTTCCTCTGTTGCTTCCAGGAT No data
Right 992339968 5:75813838-75813860 TAACATTCTGAATCTTTTTCAGG No data
992339967_992339968 -4 Left 992339967 5:75813819-75813841 CCAGGATTAGCTTAACAACTAAC No data
Right 992339968 5:75813838-75813860 TAACATTCTGAATCTTTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992339968 Original CRISPR TAACATTCTGAATCTTTTTC AGG Intergenic
No off target data available for this crispr