ID: 992339969

View in Genome Browser
Species Human (GRCh38)
Location 5:75813847-75813869
Sequence GAATCTTTTTCAGGTAAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992339967_992339969 5 Left 992339967 5:75813819-75813841 CCAGGATTAGCTTAACAACTAAC No data
Right 992339969 5:75813847-75813869 GAATCTTTTTCAGGTAAATCAGG No data
992339966_992339969 17 Left 992339966 5:75813807-75813829 CCTCTGTTGCTTCCAGGATTAGC No data
Right 992339969 5:75813847-75813869 GAATCTTTTTCAGGTAAATCAGG No data
992339965_992339969 21 Left 992339965 5:75813803-75813825 CCTTCCTCTGTTGCTTCCAGGAT No data
Right 992339969 5:75813847-75813869 GAATCTTTTTCAGGTAAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992339969 Original CRISPR GAATCTTTTTCAGGTAAATC AGG Intergenic
No off target data available for this crispr