ID: 992348257

View in Genome Browser
Species Human (GRCh38)
Location 5:75902466-75902488
Sequence GTTGAAGCACAGAAACCTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992348257_992348263 5 Left 992348257 5:75902466-75902488 CCTCTAGGTTTCTGTGCTTCAAC No data
Right 992348263 5:75902494-75902516 TAAAAAGGAACCTTTGGATTTGG No data
992348257_992348259 -10 Left 992348257 5:75902466-75902488 CCTCTAGGTTTCTGTGCTTCAAC No data
Right 992348259 5:75902479-75902501 GTGCTTCAACCCAGGTAAAAAGG No data
992348257_992348261 -1 Left 992348257 5:75902466-75902488 CCTCTAGGTTTCTGTGCTTCAAC No data
Right 992348261 5:75902488-75902510 CCCAGGTAAAAAGGAACCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992348257 Original CRISPR GTTGAAGCACAGAAACCTAG AGG (reversed) Intergenic
No off target data available for this crispr