ID: 992358450

View in Genome Browser
Species Human (GRCh38)
Location 5:76010212-76010234
Sequence TGGGAAGAGCCTAGGGAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992358450_992358456 3 Left 992358450 5:76010212-76010234 CCTCTCTCCCTAGGCTCTTCCCA No data
Right 992358456 5:76010238-76010260 TGCAGAGAAATTCATAATTACGG No data
992358450_992358459 18 Left 992358450 5:76010212-76010234 CCTCTCTCCCTAGGCTCTTCCCA No data
Right 992358459 5:76010253-76010275 AATTACGGGAGCCCAGCTGTGGG No data
992358450_992358458 17 Left 992358450 5:76010212-76010234 CCTCTCTCCCTAGGCTCTTCCCA No data
Right 992358458 5:76010252-76010274 TAATTACGGGAGCCCAGCTGTGG No data
992358450_992358457 4 Left 992358450 5:76010212-76010234 CCTCTCTCCCTAGGCTCTTCCCA No data
Right 992358457 5:76010239-76010261 GCAGAGAAATTCATAATTACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992358450 Original CRISPR TGGGAAGAGCCTAGGGAGAG AGG (reversed) Intergenic
No off target data available for this crispr