ID: 992358452

View in Genome Browser
Species Human (GRCh38)
Location 5:76010219-76010241
Sequence TGCATCCTGGGAAGAGCCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992358452_992358456 -4 Left 992358452 5:76010219-76010241 CCCTAGGCTCTTCCCAGGATGCA No data
Right 992358456 5:76010238-76010260 TGCAGAGAAATTCATAATTACGG No data
992358452_992358459 11 Left 992358452 5:76010219-76010241 CCCTAGGCTCTTCCCAGGATGCA No data
Right 992358459 5:76010253-76010275 AATTACGGGAGCCCAGCTGTGGG No data
992358452_992358457 -3 Left 992358452 5:76010219-76010241 CCCTAGGCTCTTCCCAGGATGCA No data
Right 992358457 5:76010239-76010261 GCAGAGAAATTCATAATTACGGG No data
992358452_992358458 10 Left 992358452 5:76010219-76010241 CCCTAGGCTCTTCCCAGGATGCA No data
Right 992358458 5:76010252-76010274 TAATTACGGGAGCCCAGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992358452 Original CRISPR TGCATCCTGGGAAGAGCCTA GGG (reversed) Intergenic
No off target data available for this crispr