ID: 992358454

View in Genome Browser
Species Human (GRCh38)
Location 5:76010231-76010253
Sequence TATGAATTTCTCTGCATCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992358454_992358458 -2 Left 992358454 5:76010231-76010253 CCCAGGATGCAGAGAAATTCATA No data
Right 992358458 5:76010252-76010274 TAATTACGGGAGCCCAGCTGTGG No data
992358454_992358462 30 Left 992358454 5:76010231-76010253 CCCAGGATGCAGAGAAATTCATA No data
Right 992358462 5:76010284-76010306 AGCCTTCATGCCTGCTCGTCAGG No data
992358454_992358459 -1 Left 992358454 5:76010231-76010253 CCCAGGATGCAGAGAAATTCATA No data
Right 992358459 5:76010253-76010275 AATTACGGGAGCCCAGCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992358454 Original CRISPR TATGAATTTCTCTGCATCCT GGG (reversed) Intergenic
No off target data available for this crispr