ID: 992358455

View in Genome Browser
Species Human (GRCh38)
Location 5:76010232-76010254
Sequence TTATGAATTTCTCTGCATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992358455_992358462 29 Left 992358455 5:76010232-76010254 CCAGGATGCAGAGAAATTCATAA No data
Right 992358462 5:76010284-76010306 AGCCTTCATGCCTGCTCGTCAGG No data
992358455_992358463 30 Left 992358455 5:76010232-76010254 CCAGGATGCAGAGAAATTCATAA No data
Right 992358463 5:76010285-76010307 GCCTTCATGCCTGCTCGTCAGGG No data
992358455_992358459 -2 Left 992358455 5:76010232-76010254 CCAGGATGCAGAGAAATTCATAA No data
Right 992358459 5:76010253-76010275 AATTACGGGAGCCCAGCTGTGGG No data
992358455_992358458 -3 Left 992358455 5:76010232-76010254 CCAGGATGCAGAGAAATTCATAA No data
Right 992358458 5:76010252-76010274 TAATTACGGGAGCCCAGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992358455 Original CRISPR TTATGAATTTCTCTGCATCC TGG (reversed) Intergenic
No off target data available for this crispr