ID: 992358458

View in Genome Browser
Species Human (GRCh38)
Location 5:76010252-76010274
Sequence TAATTACGGGAGCCCAGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992358452_992358458 10 Left 992358452 5:76010219-76010241 CCCTAGGCTCTTCCCAGGATGCA No data
Right 992358458 5:76010252-76010274 TAATTACGGGAGCCCAGCTGTGG No data
992358450_992358458 17 Left 992358450 5:76010212-76010234 CCTCTCTCCCTAGGCTCTTCCCA No data
Right 992358458 5:76010252-76010274 TAATTACGGGAGCCCAGCTGTGG No data
992358455_992358458 -3 Left 992358455 5:76010232-76010254 CCAGGATGCAGAGAAATTCATAA No data
Right 992358458 5:76010252-76010274 TAATTACGGGAGCCCAGCTGTGG No data
992358454_992358458 -2 Left 992358454 5:76010231-76010253 CCCAGGATGCAGAGAAATTCATA No data
Right 992358458 5:76010252-76010274 TAATTACGGGAGCCCAGCTGTGG No data
992358453_992358458 9 Left 992358453 5:76010220-76010242 CCTAGGCTCTTCCCAGGATGCAG No data
Right 992358458 5:76010252-76010274 TAATTACGGGAGCCCAGCTGTGG No data
992358449_992358458 18 Left 992358449 5:76010211-76010233 CCCTCTCTCCCTAGGCTCTTCCC No data
Right 992358458 5:76010252-76010274 TAATTACGGGAGCCCAGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992358458 Original CRISPR TAATTACGGGAGCCCAGCTG TGG Intergenic
No off target data available for this crispr