ID: 992358459

View in Genome Browser
Species Human (GRCh38)
Location 5:76010253-76010275
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992358452_992358459 11 Left 992358452 5:76010219-76010241 CCCTAGGCTCTTCCCAGGATGCA No data
Right 992358459 5:76010253-76010275 AATTACGGGAGCCCAGCTGTGGG No data
992358454_992358459 -1 Left 992358454 5:76010231-76010253 CCCAGGATGCAGAGAAATTCATA No data
Right 992358459 5:76010253-76010275 AATTACGGGAGCCCAGCTGTGGG No data
992358455_992358459 -2 Left 992358455 5:76010232-76010254 CCAGGATGCAGAGAAATTCATAA No data
Right 992358459 5:76010253-76010275 AATTACGGGAGCCCAGCTGTGGG No data
992358453_992358459 10 Left 992358453 5:76010220-76010242 CCTAGGCTCTTCCCAGGATGCAG No data
Right 992358459 5:76010253-76010275 AATTACGGGAGCCCAGCTGTGGG No data
992358449_992358459 19 Left 992358449 5:76010211-76010233 CCCTCTCTCCCTAGGCTCTTCCC No data
Right 992358459 5:76010253-76010275 AATTACGGGAGCCCAGCTGTGGG No data
992358450_992358459 18 Left 992358450 5:76010212-76010234 CCTCTCTCCCTAGGCTCTTCCCA No data
Right 992358459 5:76010253-76010275 AATTACGGGAGCCCAGCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type