ID: 992358461

View in Genome Browser
Species Human (GRCh38)
Location 5:76010265-76010287
Sequence GGCTTGATTGAGCCCACAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992358461_992358462 -4 Left 992358461 5:76010265-76010287 CCAGCTGTGGGCTCAATCAAGCC No data
Right 992358462 5:76010284-76010306 AGCCTTCATGCCTGCTCGTCAGG No data
992358461_992358470 27 Left 992358461 5:76010265-76010287 CCAGCTGTGGGCTCAATCAAGCC No data
Right 992358470 5:76010315-76010337 TCACTCACCGCTAATTATCCAGG No data
992358461_992358468 3 Left 992358461 5:76010265-76010287 CCAGCTGTGGGCTCAATCAAGCC No data
Right 992358468 5:76010291-76010313 ATGCCTGCTCGTCAGGGTGGGGG No data
992358461_992358467 2 Left 992358461 5:76010265-76010287 CCAGCTGTGGGCTCAATCAAGCC No data
Right 992358467 5:76010290-76010312 CATGCCTGCTCGTCAGGGTGGGG No data
992358461_992358463 -3 Left 992358461 5:76010265-76010287 CCAGCTGTGGGCTCAATCAAGCC No data
Right 992358463 5:76010285-76010307 GCCTTCATGCCTGCTCGTCAGGG No data
992358461_992358471 28 Left 992358461 5:76010265-76010287 CCAGCTGTGGGCTCAATCAAGCC No data
Right 992358471 5:76010316-76010338 CACTCACCGCTAATTATCCAGGG No data
992358461_992358465 0 Left 992358461 5:76010265-76010287 CCAGCTGTGGGCTCAATCAAGCC No data
Right 992358465 5:76010288-76010310 TTCATGCCTGCTCGTCAGGGTGG No data
992358461_992358466 1 Left 992358461 5:76010265-76010287 CCAGCTGTGGGCTCAATCAAGCC No data
Right 992358466 5:76010289-76010311 TCATGCCTGCTCGTCAGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992358461 Original CRISPR GGCTTGATTGAGCCCACAGC TGG (reversed) Intergenic
No off target data available for this crispr