ID: 992358463

View in Genome Browser
Species Human (GRCh38)
Location 5:76010285-76010307
Sequence GCCTTCATGCCTGCTCGTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992358461_992358463 -3 Left 992358461 5:76010265-76010287 CCAGCTGTGGGCTCAATCAAGCC No data
Right 992358463 5:76010285-76010307 GCCTTCATGCCTGCTCGTCAGGG No data
992358455_992358463 30 Left 992358455 5:76010232-76010254 CCAGGATGCAGAGAAATTCATAA No data
Right 992358463 5:76010285-76010307 GCCTTCATGCCTGCTCGTCAGGG No data
992358460_992358463 -2 Left 992358460 5:76010264-76010286 CCCAGCTGTGGGCTCAATCAAGC No data
Right 992358463 5:76010285-76010307 GCCTTCATGCCTGCTCGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992358463 Original CRISPR GCCTTCATGCCTGCTCGTCA GGG Intergenic
No off target data available for this crispr