ID: 992358464

View in Genome Browser
Species Human (GRCh38)
Location 5:76010286-76010308
Sequence ACCCTGACGAGCAGGCATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992358464_992358471 7 Left 992358464 5:76010286-76010308 CCTTCATGCCTGCTCGTCAGGGT No data
Right 992358471 5:76010316-76010338 CACTCACCGCTAATTATCCAGGG No data
992358464_992358473 16 Left 992358464 5:76010286-76010308 CCTTCATGCCTGCTCGTCAGGGT No data
Right 992358473 5:76010325-76010347 CTAATTATCCAGGGAAAAGACGG No data
992358464_992358470 6 Left 992358464 5:76010286-76010308 CCTTCATGCCTGCTCGTCAGGGT No data
Right 992358470 5:76010315-76010337 TCACTCACCGCTAATTATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992358464 Original CRISPR ACCCTGACGAGCAGGCATGA AGG (reversed) Intergenic
No off target data available for this crispr