ID: 992358465

View in Genome Browser
Species Human (GRCh38)
Location 5:76010288-76010310
Sequence TTCATGCCTGCTCGTCAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992358461_992358465 0 Left 992358461 5:76010265-76010287 CCAGCTGTGGGCTCAATCAAGCC No data
Right 992358465 5:76010288-76010310 TTCATGCCTGCTCGTCAGGGTGG No data
992358460_992358465 1 Left 992358460 5:76010264-76010286 CCCAGCTGTGGGCTCAATCAAGC No data
Right 992358465 5:76010288-76010310 TTCATGCCTGCTCGTCAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992358465 Original CRISPR TTCATGCCTGCTCGTCAGGG TGG Intergenic
No off target data available for this crispr