ID: 992358465 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 5:76010288-76010310 |
Sequence | TTCATGCCTGCTCGTCAGGG TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
992358460_992358465 | 1 | Left | 992358460 | 5:76010264-76010286 | CCCAGCTGTGGGCTCAATCAAGC | No data | ||
Right | 992358465 | 5:76010288-76010310 | TTCATGCCTGCTCGTCAGGGTGG | No data | ||||
992358461_992358465 | 0 | Left | 992358461 | 5:76010265-76010287 | CCAGCTGTGGGCTCAATCAAGCC | No data | ||
Right | 992358465 | 5:76010288-76010310 | TTCATGCCTGCTCGTCAGGGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
992358465 | Original CRISPR | TTCATGCCTGCTCGTCAGGG TGG | Intergenic | ||