ID: 992358466

View in Genome Browser
Species Human (GRCh38)
Location 5:76010289-76010311
Sequence TCATGCCTGCTCGTCAGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992358460_992358466 2 Left 992358460 5:76010264-76010286 CCCAGCTGTGGGCTCAATCAAGC No data
Right 992358466 5:76010289-76010311 TCATGCCTGCTCGTCAGGGTGGG No data
992358461_992358466 1 Left 992358461 5:76010265-76010287 CCAGCTGTGGGCTCAATCAAGCC No data
Right 992358466 5:76010289-76010311 TCATGCCTGCTCGTCAGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992358466 Original CRISPR TCATGCCTGCTCGTCAGGGT GGG Intergenic
No off target data available for this crispr