ID: 992358469

View in Genome Browser
Species Human (GRCh38)
Location 5:76010294-76010316
Sequence GATCCCCCACCCTGACGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992358469_992358470 -2 Left 992358469 5:76010294-76010316 CCTGCTCGTCAGGGTGGGGGATC No data
Right 992358470 5:76010315-76010337 TCACTCACCGCTAATTATCCAGG No data
992358469_992358473 8 Left 992358469 5:76010294-76010316 CCTGCTCGTCAGGGTGGGGGATC No data
Right 992358473 5:76010325-76010347 CTAATTATCCAGGGAAAAGACGG No data
992358469_992358471 -1 Left 992358469 5:76010294-76010316 CCTGCTCGTCAGGGTGGGGGATC No data
Right 992358471 5:76010316-76010338 CACTCACCGCTAATTATCCAGGG No data
992358469_992358475 23 Left 992358469 5:76010294-76010316 CCTGCTCGTCAGGGTGGGGGATC No data
Right 992358475 5:76010340-76010362 AAAGACGGTTGAATTATGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992358469 Original CRISPR GATCCCCCACCCTGACGAGC AGG (reversed) Intergenic
No off target data available for this crispr