ID: 992358470

View in Genome Browser
Species Human (GRCh38)
Location 5:76010315-76010337
Sequence TCACTCACCGCTAATTATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992358460_992358470 28 Left 992358460 5:76010264-76010286 CCCAGCTGTGGGCTCAATCAAGC No data
Right 992358470 5:76010315-76010337 TCACTCACCGCTAATTATCCAGG No data
992358461_992358470 27 Left 992358461 5:76010265-76010287 CCAGCTGTGGGCTCAATCAAGCC No data
Right 992358470 5:76010315-76010337 TCACTCACCGCTAATTATCCAGG No data
992358469_992358470 -2 Left 992358469 5:76010294-76010316 CCTGCTCGTCAGGGTGGGGGATC No data
Right 992358470 5:76010315-76010337 TCACTCACCGCTAATTATCCAGG No data
992358464_992358470 6 Left 992358464 5:76010286-76010308 CCTTCATGCCTGCTCGTCAGGGT No data
Right 992358470 5:76010315-76010337 TCACTCACCGCTAATTATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992358470 Original CRISPR TCACTCACCGCTAATTATCC AGG Intergenic
No off target data available for this crispr